Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GIP4
Systematic Name YAL031C
Alias FUN21
Strain S288c
Description Cytoplasmic protein that regulates protein phosphatase 1 Glc7p; protein overexpression relocalizes Glc7p from the nucleus and prevents chromosome segregation; potential Cdc28p substrate
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>GIP4 YAL031C
ATGGTAGATGTGCAAAAGAGAAAAAAGTTGCTAGCCAAAGCTGCTGCCAGCGCTTCTATT
CCGGCAATCAAAGGTTCTGTTCCGTTGGACTCGTATGATATAAAAATCATTCAATATAAG
AACGCTCTTTACAAGCTGAATGAACTGAATAGGCTACTAAACGTTCTGGTACCGCATTTG
AAGAAGAAAAGAGACAATGACGAGTCCTACAAAATTATTCCCCTCGTTAATTTCATCTTA
TCACTTTGTGAGGGTCCTATATTTAATGTAAGCCCCGTATTGGCTAAGAGGTACCATTTG
CTCTGTCGATTCCAGCTGATAAAGCTAAGCGAAGTGCAGCAGAGATTATCAACTAATTTT
ATTGATGTAGAGGGCTGGATGTTTCCCGAGGAGGTACCCCTAGATCACTATAAATCGTGC
ATATACAATAATTCTCTACAATGGAAGATTTTAAATTCGCTGTCTTGCATTGCTCAAAAT
GCTATAAAAATTTATAATGCCAAGTTGAGACAGATTTTATTGGAAAGGGATGCGTACAAA
GCTCGGTCACTTCCATTTGACACTTCAATAATTGAAGACTTGTTAAATCCAGTTGAAATG
ACATTGATTCTAGATTTAGCCGTTTTGATTAATGATCCAGTAAGGGATAAGTCCACCCAT
TCCTTTTACAAATTGCAATGGCAAGTGATGGAGAAACTGAACTCCTGTGTTCATTCGAAA
ATCTTCCCCATTCTAAGGACATATTACAACCAATTGCAGAAATTTTCGGAAACAAGACCT
ACTTCACTGTCAAATTTACAGAAGGATCTACCACATTGGGAATGGACTCTACACAGGATA
TACACTTTCCACTTGCGGGTTTTTTCTGTCTTGTGTGTTATTATCAGTTTCTCTAGGCAA
ATTTTCCTACCGAATAAACAACATTTCTTGGACATCAAGACAAGATTATCCAGCGAAAAC
GTGTACCATTACGATTTGATAATTTGTGAGCTGATGGCTTTGCTCTCTCCAGAATGTGAT
GATGTCACAGCTTTATTCGAACTGCAGGAGAATTTAAAATTTTGGACTCAAACGGCGCGT
ACCGATAACAATTCCTCAAGAACTCCCATTTTCCACCTTCAACCTGGTTTAGTTGTGGAA
TTGTTTAATAATCATATCTGCAAGATTATACCGAAATTGAGGTCCATTATGGGATTATTA
TCCAATTGGATGGATTGCTGGAAATATATTGAGAAAAATTATAAAACCTTCGATGAAACC
AATGACTTGCGGGAGAATTTGAAAGAAAAGCTAGAAAGAGATAAGGCTCTGTATTTAGAG
GTTAAAAACGCGAAAAGTAAGCTAAAGAAGAAGCCGTCAATAACAAAGCTGCCAGCCTCT
TCTTCTCCATCCCCCTCACCCACATCTTCAGCAAGCCCATCAAGACAGGCCTCTTTAGAG
AGCATAAGAACAAGGGCAAGGGCGCATTTAGCCTCAAATTCTTCTAGGTCTCCCTCAGTA
TCGCCTGTAAGGACCACTTTCAACAATAAAAACGCAGAAACGAAGAAAAGCGTGGTGTCT
CCGGAGAAAAGAAAACTGATCAACGGCAGAAGGCCTAGATCCTCATCTTTGCAATCCTAT
ACAAACAAACAACAAACCTCATATTTGAATTCTACAAGACATCCGTCAATAGCTCCACCT
TCAAAGCTCAACAATCAAAGGTCCAATTCTTTGCAGTCCTCAACCATGACGTTAAATCAA
AAAATCGTCCAAGATACAGTGCGGCATTTGATGAACAAAAGTGCATCTACACCCAATCCT
TCTGCATCTTCATCGTTAGCGCCTTCACCAAAAGTATCCAGTATAAACAACACCTCCTCA
GGAAAATCATCAAGTACCCTGATTGCCAATAGTAGTGATACTTTGGCTATAGAGACATTA
ACTCTAGATCCGGAGTCAAACTCCAGTGAATTGTCCATCAAAAGGGTGAGATTTGCTGGT
GTACCGCCAATGACAGAGGCAGAAAATCCTAAACCAACAAAGGTGGGTTGGTACAAGAAG
CCGGCTGTGCTACATTATCCGCCAATACCTGCTTCGGCAATGATCAAGCCGCTACAGCAT
AAGTCCAAATATAACACGCTGAGACAAGAAGAAGGGTTTACCTTTCGAAAAAGTCTTCGA
GATGGATTAGAGTGGGAAAATGGCGAATCTGGCTCCGAAACTACCATGATGCCGTTTGGG
ATCGAAATCAAAGAGTCGACCGGGCATAGAATAGCTTCTAAAATCAGAAGCAAATTGAGA
TAA
Promoter Sequence
Download FASTA
>GIP4 YAL031C
GCTAACGTGATCAAAAGAGAAAATCTGTCTTTGCCAGGGAAGATGGAAATTATGCTTTCT
GCCCAATTTGACTCTGCTAAAAACCATCTGCGTTATGACACTAGTGCAATAACACAGAAC
AGCAATACAGAGGGCTTAGCTACTGTCAGTAAAATTATAAAATTAGACAGAAAATAAGAA
CAAAGTAAATATACGCCCATATATGTATATATGTATATATACATATATCCTACACTACAT
ATGGAAGCTCCCTATATATATAGCATTGCGAGTGAACTTCTATCGACTAAAGTGAACAGC
AATGGGGACGATGATTACAACAAGCAATATGATGATTACTAAAGCCAGACACATCTTCAT
TTTTAGATCCTTGTACCACATGGCTTTTCTGACCCTATTGGCACCCCTCTTAAAGCCTTG
GGCTGAGACCGCTAGGTTATCGGCTTTATCTTCAATGGACGTTAATCTTTCACCTCTTTC
TGCTACTTTATTTATGTTATCTCTCATTATTCCCACGGTATCATCAATTTCCTAAAAATA
AACACGAAGAACGTATATGAATGTATACGCATAAGTATCAACGATGTAGAAAGTTAGTAT
AATGTTAATTTCCTAGATGGTACTCTGTGGCTTTCTGTACTTACAGCTTGTAGTTCCGCA
GTCCTTGACTTAGACTGTACATTCTGGGGTCGTTCTTCATCGTGCTCGGATAGAGCATAA
GGGTCAAAGGGAGTAGATGACGACATGGACAATGAATACGTTGCGCTTGCTATGTCTTTG
GCGCAAATTTTCAATGTTTAACTAATACTTTTGACGATCTTTCTTATAGATGCTGTGGGA
AAGACCCTTAAAAATGTCTGTTACCCTGCAATCAATGGTTGAAACAGCAGGAAGACGCAT
AATAAAGGCATATGTTTGAAGTTTGTTAGCGAATGAACAATGATAAAAGGAGTGATTGGA
AGCTGAAGGTTGAGGATTTAGACTAGTTTTATATTACAAC
Chr coordinates Chr I from 87031-84749
w3c xhtml validator w3c css validator