Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FUN12
Systematic Name YAL035W
Alias eIF5B, yIF2
Strain S288c
Description GTPase, required for general translation initiation by promoting Met-tRNAiMet binding to ribosomes and ribosomal subunit joining; homolog of bacterial IF2
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>FUN12 YAL035W
ATGGCGAAAAAGAGTAAAAAGAACCAACAGAACTACTGGGATGAGGAATTCGAAGAAGAC
GCCGCCCAGAACGAAGAAATCAGTGCCACGCCAACTCCAAATCCAGAAAGCAGCGCAGGT
GCAGATGACACTTCCAGAGAAGCAAGTGCAAGTGCTGAAGGTGCTGAGGCCATTGAAGGC
GACTTCATGTCTACTTTGAAGCAATCGAAGAAGAAGCAAGAAAAGAAGGTTATTGAAGAG
AAGAAGGATGGTAAGCCTATACTAAAGTCCAAGAAGGAAAAGGAGAAGGAAAAAAAGGAA
AAGGAGAAGCAGAAGAAGAAAGAACAAGCTGCCAGGAAGAAGGCCCAACAGCAAGCTCAA
AAGGAGAAGAACAAGGAGTTGAACAAGCAAAATGTTGAAAAAGCTGCTGCTGAGAAGGCT
GCTGCTGAGAAATCCCAAAAATCTAAAGGTGAAAGTGATAAACCAAGTGCTAGTGCTAAG
AAGCCAGCCAAGAAAGTACCTGCCGGTTTGGCTGCTTTGAGACGTCAATTAGAATTGAAG
AAACAACTTGAAGAACAAGAAAAGTTGGAAAGAGAGGAAGAAGAAAGATTGGAGAAAGAA
GAGGAGGAAAGATTGGCCAACGAAGAAAAAATGAAGGAAGAAGCTAAAGCAGCTAAAAAG
GAAAAGGAGAAGGCAAAGCGTGAAAAACGAAAGGCTGAAGGTAAGCTATTGACCAGAAAG
CAAAAAGAAGAAAAGAAATTATTGGAAAGAAGACGTGCCGCTTTATTGTCTTCCGGTAAC
GTCAAAGTTGCCGGTCTGGCCAAGAAGGATGGAGAAGAAAACAAACCAAAGAAGGTTGTT
TACAGCAAGAAGAAGAAGAGAACAACCCAGGAAAACGCCTCCGAAGCCATTAAATCTGAC
TCTAAGAAAGACTCGGAAGTTGTACCTGATGACGAACTCAAAGAATCCGAAGATGTTTTG
ATTGATGATTGGGAAAATTTGGCTCTTGGTGATGATGACGAGGAGGGAACCAACGAAGAA
ACGCAAGAATCCACCGCAAGCCATGAAAATGAAGACCAAAATCAAGGCGAAGAAGAAGAA
GAAGGAGAAGAAGAAGAAGAAGAAGAAGAAGAAAGAGCACATGTGCATGAAGTTGCCAAA
AGCACACCAGCAGCTACACCAGCAGCTACTCCAACTCCATCCAGCGCTTCTCCAAACAAA
AAAGATCTTCGTTCCCCAATTTGTTGTATTTTGGGTCATGTCGATACCGGTAAGACTAAA
TTGTTAGACAAAATCAGACAAACCAACGTTCAAGGTGGTGAAGCTGGTGGCATCACCCAA
CAGATTGGTGCCACTTATTTCCCCATCGACGCTATTAAGGCAAAAACTAAAGTTATGGCT
GAATATGAAAAACAAACTTTTGATGTCCCAGGTCTTTTGGTTATTGATACCCCAGGTCAC
GAATCCTTCTCTAACTTACGTTCAAGAGGTTCTTCATTGTGTAACATCGCAATTTTGGTT
ATTGACATTATGCATGGTTTGGAACAACAGACTATTGAATCTATCAAACTGTTAAGAGAT
AGAAAGGCTCCATTTGTCGTTGCCCTAAACAAAATTGATAGATTATATGACTGGAAAGCC
ATTCCAAACAATTCATTCAGAGACTCCTTTGCAAAGCAATCAAGAGCTGTTCAAGAGGAA
TTTCAATCTAGGTATTCTAAGATTCAATTGGAATTAGCTGAACAAGGTTTGAATTCGGAA
TTGTATTTCCAAAACAAAAATATGTCTAAGTATGTCTCCATTGTCCCAACATCTGCCGTC
ACCGGTGAGGGTGTTCCAGATTTATTGTGGTTGCTATTAGAATTGACCCAAAAGAGGATG
TCCAAACAATTGATGTACTTGTCTCACGTGGAAGCAACCATTTTGGAAGTGAAAGTCGTA
GAAGGTTTTGGTACCACAATTGATGTTATCTTGTCCAACGGTTACTTGAGAGAAGGTGAC
CGTATTGTACTGTGTGGTATGAATGGTCCAATTGTAACGAATATCAGAGCATTACTAACA
CCACAACCATTACGTGAACTACGTTTGAAATCTGAATATGTCCACCACAAAGAAGTCAAG
GCTGCTTTAGGTGTCAAGATTGCCGCTAATGATTTAGAAAAAGCCGTTTCTGGTTCTAGG
CTGCTAGTTGTCGGTCCTGAAGATGACGAAGATGAATTGATGGACGACGTTATGGATGAT
TTGACTGGTTTGTTGGACTCCGTTGACACAACTGGTAAAGGTGTTGTGGTCCAAGCATCC
ACCTTGGGTTCTTTGGAAGCTTTGTTGGATTTCTTGAAAGACATGAAAATCCCTGTGATG
TCTATCGGGTTAGGTCCAGTGTACAAGCGTGATGTTATGAAAGCCTCCACTATGTTGGAA
AAGGCTCCAGAGTATGCCGTGATGTTATGTTTTGATGTTAAAGTGGATAAGGAAGCTGAA
CAATACGCTGAACAAGAAGGAATTAAGATCTTTAATGCAGACGTCATCTATCATTTATTT
GATTCATTTACAGCATACCAAGAAAAGTTATTGGAAGAACGTCGTAAAGATTTCCTAGAT
TACGCTATTTTCCCATGTGTCTTACAAACCTTACAAATTATTAACAAACGTGGTCCAATG
ATTATTGGTGTAGACGTTCTGGAAGGTACTCTACGTGTGGGAACTCCTATTTGCGCTGTG
AAAACCGACCCTACTACAAAGGAAAGACAAACTTTGATATTAGGTAAAGTCATCTCTTTA
GAAATCAACCATCAACCTGTCCAAGAAGTAAAGAAGGGCCAAACCGCTGCTGGTGTTGCC
GTCCGTCTAGAAGATCCCTCCGGTCAACAACCTATCTGGGGTCGTCATGTTGACGAGAAT
GATACATTATACTCCTTGGTTTCAAGAAGATCTATTGACACTTTGAAGGATAAAGCTTTT
AGGGACCAAGTTGCTAGATCCGATTGGCTGCTATTGAAGAAGCTGAAGGTCGTTTTCGGC
ATCGAATGA
Promoter Sequence
Download FASTA
>FUN12 YAL035W
GTATCTTCTTGACGAAGCTTCCAAAACATCAATCAAATCATCCACAGTGGCATCACACCT
GAAGGCAATCTCAGCGCTATTTATTCTGTACTCGCTCATAACGGCTCTGATTTCGTCATT
CCCCAGATGGGTCAATGGGACTGTGTTTGTGATGGAAATACCACCTTTCTCTTTTTTTTT
GATCAAGATATCTGGCGGAGTTTTATTCAGACGAATCCCCACACCTTCCAGTTCCTTCTC
AATGATTTGCTTATGATGCAAGGGTTTGTTCACATCTAGGATGATAAATAACAGGTTACA
GGTTCTTGCCACGGCAATAACTTGCTTACCTCTACCTCTACCATCCTTAGCACCATCGAT
AATACCAGGTAAATCCAACATTTGGATCTTGGCACCTTTATAACGAATGACACCGGGGAC
GGTAACCAGGGTGGTAAACTCGTACTCAGCTGCTTCAGACTCAGTACCAGTCAACTTGGA
CAGTAATGTAGATTTCCCCACCGACGGGAACCCGACAAACCCCACACTGGCCACACCAGT
TCTAGCCACATCAAAACCAATACCAGCACCACCACCGCTGCCGGATGAAGCACTGGTCAA
CAATTCTCTTCTCAGTTTGGCCAGCTTGGCCTTCAGTTGACCCAAATGGAAAGATGTGGC
CTTGTTCTTTTGGGTACGGGCCATTTCATCTTCGATAGCTTTGATTTTTTCAACTGTAGT
AGACATTTTGCTCAATCAACAACTCTACGCTTGCACCTACTGCATCTAGCTTCAAACACT
TCCTATCATTGCGCCCTCATCACACCGTAATATCCCATCTTAAAAGTGGAAAACTCTTAT
AGCTCATCGATGAAAAAAACGGGCCCTCGTCGCTTGTGATGTGAAAAAATTTTTCAAGCT
TTAAGCCCATTGAAAGCAAGAGATCTTGCACTAGAATAAGTGGCAAAGGTGAACTTTGAG
GGGATAAGAAGGGCAATCAGGAACATCAGATAAGTGAAAG
Chr coordinates Chr I from 76427-79435
w3c xhtml validator w3c css validator