Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YAR075W
Strain S288c
Description Non-functional protein with homology IMP dehydrogenase; YAR073W/IMD1 and YAR075W comprise a continuous reading frame in some strains of S. cerevisiae.
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAR075W	6319353 upstream sequence, from -1000 to -1, size 1000
GGTGGGTTGGCTTATAACGATTTTTTAATCTTACCAGGTTTAGTCGATTTTGCGTCCTCT
GAAGTTAGCCTACAGACCAAGCTAACCAGGAATATTACTTTAAACATTCCATTAGTATCC
TCTCCAATGGACACTGTGACGGAATCTGAAATGGCCACTTTTATGGCTCTGTTGGATGGT
ATCGGTTTCATTCACCATAACTGTACTCCAGAGGACCAAGCTGACATGGTCAGAAGAGTC
AAGAACTATGAAAATGGGTTTATTAACAACCCTATAGTGATTTCTCCAACTACGACCGTT
GGTGAAGCTAAGAGCATGAAGGAAAAGTATGGATTTGCAGGCTTCCCTGTCACGGCAGAT
GGAAAGAGAAATGCAAAGTTGGTGGGTGCCATCACCTCTCGTGATATACAATTCGTTGAG
GACAACTCTTTACTCGTTCAGGATGTCATGACCAAAAACCCTGTTACCGGCGCACAAGGT
ATCACATTATCAGAAGGTAACGAAATTCTAAAGAAAATCAAAAAGGGTAGGCTACTGGTT
GTTGATGAAAAGGGTAACTTAGTTTCTATGCTTTCCCGAACTGATTTAATGAAAAATCAG
AAGTACCCATTAGCGTCCAAATCTGCCAACACCAAGCAACTGTTATGGGGTGCTTCTATT
GGGACTATGGACGCTGATAAAGAAAGACTAAGATTATTGGTAAAAGCTGGCTTGGATGTC
GTCATATTGGATTCCTCTCAAGGTAACTCTATTTTCCAATTGAACATGATCAAATGGATT
AAAGAAACTTTCCCAGATTTGGAAATCATTGCTGGTAACGTTGTCACCAAGGAACAAGCT
GCCAATTTGATTGCTGCCGGTGCGGACGGTTTGAGAATTGGTATGGGAACTGGCTCTATT
TGTATTACCCAAAAAGTTATGGCTTGTGGTAGGCCACAAGGTACAGCCGTCTACAACGTG
TGTGAATTTGCTAACCAATTCGGTGTTCCATGTATGGCTG
Chr coordinates
w3c xhtml validator w3c css validator