Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBL111C
Systematic Name YBL111C
Strain S288c
Description Helicase-like protein encoded within the telomeric Y' element
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBL111C YBL111C
GGACGGTTGATTGGTGGTAGTAAGTAGAGGGATGGATGGTGGTTGGGAGTGGTATGGTTG
AATGGGACAGGGTAACAAGTGGAGAGGTAGGGTAATGTGAGGGTAAGTTGAGAGACAGGT
TGGAAGGGTTGAAATAGGGTAGGGTTAGGGTAGTGTTAGGGTATATATATATGTCACTGT
ATTGCATGCTGGATGGTGTTAGACAAGGCCGTAGGGACATATAGCATCTAGGAAGTAACC
TTGTACGAAAATAGGCAATATTTCCTGTTTAGGCGATTGTGACGCAGATTTTAGTCCAAC
GATCTAGCGTCAAGGAATTTTTTTATAGTGGGACATTGCACCAAGGAAGTAACTTGATAC
GTCGTGGGTGAATGGGTCTGTTTTCTTATTCGGCGGGGTAATACATTTTTGGGGGAAGTT
TGTCTGTCTGACGCGCCATATGTAGGTACGCCAAAAAGGGCTCCTCTACTTCGAAGCGCG
AGGTCGTATACCTAATAAGGAAATGTAATTTATAACTTTTTATTATATTGGTCTTTTCGA
GAGCGGAACGTAGGTCCATGTTTAAAGTATCCAAGAGAATATCCACGAAGCGGCTGAGCA
ACGAACAGAATCCTGGTTCTCCTCGACTAAGCAGATAGTTAAGATACTGTGCACCATGGA
AATTGAAAACGAAAGTACGTACCGACTACTTTATTTTTGCAGGCCGGAAATCAAGCGATG
AATGAGACATCCTTCTGTTTTCTATGTTGTGCTTGAAGGGGACAGACAGTCGCTTATCTT
AGTGAGATTTCTTATTAACTGAATTTTCTTTGCTGCTGCTGGAGATTTGCACCTGCATAG
CGCAGATTCTGCTTCTTCTCAATAGAGTAGCTTAATTATTACATTCTTAGATGATGATAA
GACGGAAACTGGACAATCTTTTGTTTATATTGATGGATTTCTTGTCAAAAAGCATAGCAA
TCAACATACTATTGTTAATTTCGAAACTTACAAAAATAAA
Chr coordinates Chr II from 4116-2907,5009-4216
w3c xhtml validator w3c css validator