Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name POA1
Systematic Name YBR022W
Strain S288c
Description Phosphatase that is highly specific for ADP-ribose 1''-phosphate; a tRNA splicing metabolite; may have a role in regulation of tRNA splicing
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>POA1 YBR022W
TTTCCCCAAGTTTATCAATATCAAGCGTGGTTCATTATTTTGTGCAGCCATGGCGCTGTG
TATTTGTCCATGGAATTTAATGGCAACATCAAGTAAATTTACAATGGCTTTGTCCGCATA
TGCTATCTTTTTGTCCAGTATTGCCGGTGTTGTCTGCTCAGATTACTTTGTTGTTAGAAG
AGGATATATCAAGCTAACACACATATATTCCCATCAAAAGGGCTCTTTTTATATGTACGG
AAACAGGTTTGGTATCAATTGGAGAGCTTTGGCTGCATATCTATGTGGGGTGGCTCCTTG
CTTGCCCGGTTTCATCGCGGAGGTGGGCGCTCCCGCTATAAAGGTTTCTGATGGAGCTAT
GAAACTATATTACCTAAGTTACTGGGTAGGATATGGCTTGAGTTTTTCTTCTTATACTGC
TCTGTGTTACTTCTTCCCTGTACCTGGGTGCCCTGTTAACAACATTATAAAGGACAAGGG
CTGGTTCCAAAGATGGGCCAATGTCGATGATTTTGAAGAAGAGTGGAAAGACACAATTGA
GAGGGATGACCTGGTAGATGACAATATTAGTGTCTACGAACACGAACACGAAAAGACTTT
CATTTAAGCTCTCCATATCTACATCACTTTCTGCATTAATCTGAAATATTTTTCAAATTT
TCATGTGTAATGATATTAATCCTTATCTATACTACTTACTTCTATTTACGTTCTCTTTAG
CATTTACTTTGTGCATTTGGCCTTCAATGAGCATTAATTTCACTGGTTTTAATATATTCA
CTCACTTTCATTCGATTTTTTGTTTGCTTTATGGCTTAGCGTTCTTTCCTCTCTCCTTTC
TCTTTTTACACACGAGAAAAAATGGATAATTGTTGTATTATGCCATATGCATAACTTTAC
GATTCGTTATGCTATGCGAACTTGAAGCCCAGATTTCTACACGAAAAGTTTGAGTTTATT
AGTATCTTCTCCAAGATAAATATAGCATCAAGTTACAGGT
Chr coordinates Chr II from 283738-284271
w3c xhtml validator w3c css validator