Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name QDR3
Systematic Name YBR043C
Alias AQR2
Strain S288c
Description Multidrug transporter of the major facilitator superfamily; member of the 12-spanner drug:H(+) antiporter DHA1 family; has a role in polyamine homeostasis; involved in spore wall asembly; sequence similarity to DTR1 and QDR1, and the triple mutant dtr1 qdr1 qdr3 exhibits reduced dityrosine fluorescence relative to the single mutants; expression is upregulated under polyamine stress; required for resistance to quinidine, barban, cisplatin, and bleomycin
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>QDR3 YBR043C
GCAGTATCGAATCCATAAAAGCGACCACAGGGGAGGCATTCTTATATAACTCCATTGATG
CTGAAGCGATTCCAAATAAAGTTCCGAAATCCTTCCTCCAAAATACGGTCACTTTAAGCA
TTGGTGGACATAACGAAATCGAAATCGACAGAAGAAGAAATGCAATAGATAATTGCTTAA
ATAACGTCCTATGTCATGGGCTGGCCAAAGGTTTCATCCCAGGTTACGGCATCTCCCTAC
TGAAGGCAATTCCAGGTTTGAATGAACTGAAAGCAAATGAACCCAATTTCATGACTAAGG
TAGGCATCAATGCTGTTTTATCAGCAGTTATTCTCCCATCAGAAGTGGCGTTTAAGAATG
CATATGGGTACAACTATTATGAGATCAATAGCCTGATAGCAGGCGCTATAAACGAAAAAT
CGTTTCCAATGGCCAAGTTTTCTCCAAATTCAGAACCGGTGAACACAGTAAAGGATGGAA
ACTTGGAGCCATGGAGCAAAATGGATTCTTGTTTAGCCGGTGTAGAAACGTTCATTGAAT
TACTTACAAGCTGTAATACAATTATCACATGTGTATACAAAAAGCCTGAACGGCACAAAG
CCTAGATAAAGCCCTTACATACTTTTAAATAGTCAGAATGAGTCATTGTAAATAGATATT
GCCACGGCGCTGCCTTTTATCACTTTTACCTCTTCGTAAATATCTATTATTCCTGCTCAA
TTTCTCATATGCGGCTTCGGAAAAACTCGGGTTTTTCCACGCCTCAGCAGTAACTCCATC
TACCTTTGGGGATTTGAACCATCTCATTCCAGTTTTGGATAACTGCGATTAGATTAAAAT
ATTAAAAGATTATCGATTAGATAAGATAGAAACCAACAAAATTTGTTGTAATAGCTGTGT
CCTTGTATCCTTAAAAGAAAACAGGGTTGAAGGCATATGTATTCACATCTTTCTAACTTG
TTAACGTCTATGCTAGGACCGAAGTCAGAAAGCGATAAAC
Chr coordinates Chr II from 323945-321876
w3c xhtml validator w3c css validator