Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MNC1
Systematic Name YBR056W-A
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF YBR056C-B
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MNC1 YBR056W-A
ATGATGAAGTCATCCATCGGTAATTGTCCATCTTAGGTAACAATTGCGAGGCAAGTAACA
CAGACTCTCGAGTACTTGTTTTTCAGGGTGTGAGAAGAGCCGTTGTTTACTTAGTGATAA
TTCACGCTATTTTGTTGAGCAAGTCATTAAACAATCTACTACCTGTAGCTCGTGAGTGGA
ATATCAAGGTGATATACACTTTTGTGTTCTAATGAAATTCAAATACTAATATTGACGAGT
TTTCATATTACTAGTATATTATCATATAAGGTGTAAGAGAATGACATAAAGATTGAAAAA
AAGTCAACGGATGTAATGGAAGCTGGATGACAACTTCTACAATGAAAGGAGAATAATAAT
GCTATAATGTCGAAATAGCAACTCTCTTTGTGAATTCTTCGCGTGGAGTAATTCTAGTGT
CTTTTGTATTCACAATATTATAGCGTTTGAAAAACGATGTACTTCCAACAATTATTCCAA
AATTCATCTATTTCTCAATGGTAATTCCTATTGATCAATTATTTTTCAAACCACTCAATT
TAAAAAATTGTCAGAAATACCATCAATAAAAGGGTTTTATAGTGTAGTGGTTATCACTTT
CGGTTTTGATCCGGACAACCCCGGTTCGAATCCGGGTAAGACCTTATTTTTATATATTTT
TTCATGAATTATCGGACACTCTTAGAATGGAGATCTCGCAGATATGGGGCTGAGCCGTGC
TGCATCAGTTAAGAAAGAAATAAGCCACCTCGATGCTGTGGTGAATAATTTACGGGAAAT
TTCTTGGCGTTTCTGTAAGTGACATGATCCGTTATAGTGCCGCAAAGCCAAAAATGTCTT
ATTTTTAGGTTAGCATCTTTTCAGCCTCGAAAAATGCTTGTTCAGCAATAATATATAAAA
GTATCAGTAAAACAACACTTTTTGTTAGATGAACAATTGATTTTGTCTAGGTCCTTGTAC
TTTGAGAAATATCATCAAAAAAAAAAAGTGCGACATCACA
Chr coordinates Chr II from 351255-351455
w3c xhtml validator w3c css validator