Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AAC3
Systematic Name YBR085W
Alias ANC3
Strain S288c
Description Mitochondrial inner membrane ADP/ATP translocator, exchanges cytosolic ADP for mitochondrially synthesized ATP; expressed under anaerobic conditions; similar to Pet9p and Aac1p; has roles in maintenance of viability and in respiration
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AAC3 YBR085W
TAAACTGCACAGAAAAAAAATTCTTCCACAAGTTTCCTCTTTTGCCTTTTAGTGCTAAAA
CTCCGATTATAGAAACATCTGGCTTCACTAGCATATTCATGATGCAAATGGAACACAGTA
TCGTTCTTGGCATATATTACCCATATCACTTTTCAATAACGCTGGTGTTTCAGGTGATAA
CTCATCAAACTCGCATTCCTCAAGAGGGAGTTATTATAACAATTCTATCTTATTCCTGAT
AAACTTTCATAGATTCATTATTCACTGCATCACATACATTTTTGCTTTGGAGTTCTTAAT
CAACTTTCTATGTGAAGCGTAAAATCAATAGTTACCTTGTATTCTCTGTTGATCACTGTC
CAAACCTATATTTTTGTTTCCCCCTCAGAGAAGTTAGGTCGATGCCTATCGTAGTTTGCA
AGGAAGACGGCTTCCAACTGAGACCGCCCTAGTCTGGCAGGATTCGTGAAAGGAGTCCAT
GCCAGCTGCTACCCAGGGATTGCCACGGCCCCGGCCAGCGTATAGTACACTGTCAGGAGC
AATTCGAAGAGGCAACCAAAATTATGCTAAGCATCGCACTCTCTCTCAGTCTGGTGCTAA
GCGGAAGACATGCTTCCAATGGCCTCCTCACCGAGAACGGATATTAAACGAAACGAAGAA
AAAAAATCTTCACGGAAAATGCGTAATGTCTGGATGACAAAATGCATGGGTGTAAAAAAG
GAAATGAGACGAACTTGTAATAAACCTTAGTGGGTTGACGAATTTTGAAATAAAGTTTTT
CCTTTTTTTTTTTTTTTTTCTTTTTCATTGTTTGGTTGCCTTCAAATTACATATAAGATT
TCTCGAGAAGGGTTTTCCATTGTCCTTTTCATTAGGCGTTGAAGTGAATCTAAAGTGCGC
TTGAATGATTTCAGATAGAAAGACTAAAGAAGTGGTGTGAGTATAATTAACTCAATTGAA
GACGGTTTACCTGAAGTGATATACTGTGCCTTGAGAAACA
Chr coordinates Chr II from 415983-416906
w3c xhtml validator w3c css validator