Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TYR1
Systematic Name YBR166C
Strain S288c
Description Prephenate dehydrogenase involved in tyrosine biosynthesis, expression is dependent on phenylalanine levels
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TYR1 YBR166C
TTTCGGGGATAATTTCTTTACTTCCCCACCAGGCTGTTGAATTGAATATGAAAATGGTAT
GACAACAATAATGTCTAAAATTCCCAAATCAATTTGGTAAAAATCTGTCCAGCTCAATAT
GGTTGAATAATCATGAGAAGTACATCAATAGTCTTCTCATGTCATTTCGAAAAAATGTTT
TTTCTTCATTTTTTTCCTGCGATTGTTTGACCATTTGTTTAATTTCACTCTCTGTAAAGA
GCTACTTAACTATTCAGAAATAAGCAATAAGATTGACGGTCAAAGAAGAAAAGAGAACTC
TGCACCCAGGATGGCACTCAAAAAGAATACACACAACAAATCTACCAAACGAGTAACGAA
ACACCCATCTTTGAAAACTCTAACGCATAAGCAAATACACACAACAATTTTCGTTAAGTC
TACAACACCATACGTTAGTGCACTGAAAAGAATAAATAAGTTTCTCGATAGCGTTCATAA
GCAAGGATCATCCTATGTTGCGGTTTTGGGTATGGGTAAAGCTGTAGAAAAGACACTGGC
ATTAGGTTGTCATTTTCAAGATCAGAAGAACAAGAAAATAGAGGTTTACACTAAAACTAT
AGAAGTTCTTGATGAAGTAATAACTGAAGGCCAAGCTGATATCGACATGGAAAGTGATGT
TGAAGATGACGATAAAGAAACCCAACTAAAGAAAAGGGCTGTAAGCGGTGTAGAATTGCG
TATTTATGTTTAATATGTCATACTTTTAGCGCTCATTGTTATTGTATACTATTTATAGCT
AACAGTTTATTATTAGATTTCCTCTAATAAGCGTTATACCAGTGTAGTAAGTTTATCACT
TCAGCTATGTGTCATTTTTTTTTTTTTTTTTTGAGGCCTTATATGAAAATAAGCTTTGAA
GAAAGTGATACTGGAATTATTCAAACCAAGAAAAGTTTTTAGAATTACAAGAATACCGTA
GCACTTGAAGGAAAGAGGACAGCATATCCACTTGATAAAC
Chr coordinates Chr II from 571200-569842
w3c xhtml validator w3c css validator