Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DTR1
Systematic Name YBR180W
Strain S288c
Description Putative dityrosine transporter, required for spore wall synthesis; expressed during sporulation; member of the major facilitator superfamily (DHA1 family) of multidrug resistance transporters
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DTR1 YBR180W
GCAATAAAAATCGGGCGAATATTATTTTCTTCTTGAAGTTGATCCATAAAAGCTTGTGTC
TTTAATATAGATCTTTTTAAAAGTACTCTATTGTTGTTATAATTCCACTGGCTAAGTTGT
GAAGAAATTAAGTGTGCTTTTGAGTTGGAGGAACGCAATGAGGGCAACAAATCATCCTCC
CTACGCCCCTCTTCACCATCAAACAAAGTGGTACGGTCATCAGTTACTCCATGGAAATTA
CTGCCTAAAAAATGACCTTCGTTGCGTGAGTAAGTAAGAGTTTGTGGTACTATTGTGGCG
GCATCATCGTCCTGATCTGTGGAGTCCTTGTGCGGTTTATTGCTGTCTTTGAATTGTTGT
TTTCCTTCAGACATCGTTAAATGAGCCTACCGTTTTGCCTCTATCCGTGATATCAGATAA
TGTTGCTATGTTCGGATGTACTTTGCTTTATTTATTAAGGGCTACTGTAACCTGCGTTAT
CCTGTTTCAATAATGCATCGTCCGTCTTAATTAATATTAGCCCGGCCATATTCTTCAGCA
TGAAAAGCTGTATTTACCCGGACTGCGCACCAACTTTTAAATATTAATCTCCGTTCGGTC
TTTGCGCGAGTTATTATACTAGCGCCACGTATTAGTAATACTATAGCTATCTTGCCAGAT
AAGGGATCACAAGGAATTATATACCGTGGATCACAACTATCCATATCACTCTTCCCAATT
TCGCGGAGAAATACTTATGCAGGTTTCCAAATCATTTCCGTAGCCAAAGCTGCCTGTTGG
CCACTGTTTTGGCATCTCTCTACATTTTTTTTTTTCATTGATACTTTCAACCCAGACATT
CTGTCACCTGGTGAAAAACGACACAAACTCCTTTGTAACAACAATTGCAATTTTAAGATA
TATGAGAATATTGATAAGGCTAGAAGGATGGTAGTAAGAAAAGTTGTTGTTGGTAATTTT
TCAAAAAAGAGTTTCAAGAGCTGGGAAAAGAATTAAGGCA
Chr coordinates Chr II from 589741-591459
w3c xhtml validator w3c css validator