Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SMP1
Systematic Name YBR182C
Strain S288c
Description Putative transcription factor involved in regulating the response to osmotic stress; member of the MADS-box family of transcription factors
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>SMP1 YBR182C
ATGGGTAGAAGAAAAATTGAAATTGAACCTATCAAAGATGATAGAAATCGTACAGTTACT
TTCATAAAGCGAAAAGCAGGACTATTTAAAAAGGCTCATGAATTGTCAGTACTTTGCCAA
GTAGACATTGCTGTCATTATTTTAGGATCCAATAATACATTCTACGAATACTCTTCTGTT
GATATGAGTAACCTGCTTAATGTTCATCAAAACAACACTGATCTTCCTCATAATATCATA
GAACCATCTGATTATGGTGACTATGTGAAAAAACCACGTGTTGTTCTGAATGAAAGGAAG
CGCAGGCGAAGAAGAGCAACCGTGTTGCAACCAGCTTCCCATTCTGGGAGTTGTACAGTT
TCGAGTCAAGATTCCTCCAGTGTACAAAACAATGGGAATTTAAGCGCTCCGTTGGCGTCA
AATGACGCCGGGAACGCTGGTGTAAGTACACCATTGGTGCATTGCCACGGAGCAATATCA
CGTAGCGGATCCAATCATTCTGACTGTGCAAGAAATAGTGCAGATTATCAAATGTTGCAA
GGCGGTTTAAATTCTGGTGGGAGTTTTCATGCTAATGATTATAAAGAAAGCGTAGACCAA
CAGCATGTTGCAAACGAGGCTATTCATAGGAATTTTATGAACAAGAGGATTAGGCCGGAT
ACTCATTTACTACTTTCTGAATCTAACCACTCTAATTATCATAATTTTTACCCGTCGCCT
TACGAGAATTTGCCAAAGCCTTCATTGCCTGCAAGTTTAGTGGGCAATATTCCATCCTTT
CAATCGCAATTTGTACAGGTTATTCCGGCAAATAGTAACCCAATGGGAAAAGGATTTAAT
GGGACGGGTGACAGCGAGAGCTTTGAAGCAAAGCAAAAGATACACCCGACAGTTGCTATA
TCAAATACTTTGGAAGGTCCAGCTCCAGTGCAGGCGATGGTCCATCACCTGCACCAACTG
AACAGCAATAGAGGAAAGCTCTCAGGGAAGCCATATTTAAAGCTAAATATTCCGAAGGCC
ACAAATGACGCTTGCCAGAGGTCGCCAGCAATGTATTCAGGAACCGCATCACCGAAAACG
GATGTACAAGCCACTCCCAATCAAATGCTCGCCAGCAACATGTCCTCCCCTCTTTCTCGT
TCAAAGTTTTTGGGATTCAAGAACAATGATATGGACGACTTATATCATAATGGCCGATGT
GGCAGCACTTATGTAAATAACAAAACATTCTTTCTGAAACCGCCAATTGGAAGACCGCCT
AAATTTCCGAAAAGCCCGTCTTCATCTATTGTGGTTTTTCCTTCCTCGGTAGCTAGTTCA
ACTTTGAAATCCACGAGTTCGACAAACTCTCCAGATTAA
Promoter Sequence
Download FASTA
>SMP1 YBR182C
CAAACAAAAAGTTTCAGGGGCCGGATCTAATCGGCATAAATATTTTCCGATGTCTCGCGT
TAAAAAACTTGCGTGATAATCCGTCCGCACTAGTGGGATCGAAAGAAGGGGCGTGGTCAG
AAGGGTAACGTTATGTGAAACCCTTGCCTTTGAATCTTTCCTGCTATGCTACGTCGGCCG
ACACTTCCATTTGAAAAAAATATAAACGATGGTGTTGCCAAGTATTTTTTTTCGCCTTCG
TTTAACGTCAGCATTACTAAAAAGGTTAATGGTTGGCGATACTAACTAAAAAGAATTTGT
AGAAATGCCATGAAGATTTTCACGCTGTATACCATGATTCAGCAATACTTTTTTGATAAT
GGCGGTGTTTATAGTATAAAGAATTTTTATTCTGCAGTTCCGAAGGAGAAAATGAACATA
ATTCTTGTTTCACTTGATTGTGAGCTCCAAAAGCTTGCTCTTAAGCTGTCAAAGAAAACT
AGTGGCACTCACACTACGCACTAGCTTTTACACCACATCGTTATTGTTTTCCATTAACGC
TTACGTAAATTTCATCTATCATTCTACCTGTACCGTTCCCGATGATAGTGGCTTACAAAA
CGGCTTGAGGTACAGTTGGTTCGAACTTTTTGCATTATTGTTGCCTTCTTTTTTTAGTAA
CAAGCGGCGTCTTTGTTTCTTCTGCAAAAATAATCTCGCTCGAGTAATTGGAGGCTTGGC
AAAACTTAAATCTCCACGCATACCCGGCTTCCTATGTTCGTGAAGGACTCAAAAACATGA
ACTATCCTTATCCATCTTTCTTTTGCCAAATTATTTTAGCCAATCTATATAACACTACAT
CATTCCTTTGAGTCTTTCTTTATCATTCATTCGAAGGGAGAAATATACGAGCCAAATTCA
AAGACAGACTATTTTTTCGAGCAGGCCTATCTCATCAGAAAAAAATTTAATAAAGCTCTA
GATAAGCAAACACAATTATTTTCAAAAAAATTTCTGCTAA
Chr coordinates Chr II from 594864-593506
w3c xhtml validator w3c css validator