Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPT10
Systematic Name YBR264C
Strain S288c
Description Rab family GTP-binding protein that contains the PEST signal sequence specific for proteolytic enzymes; may be involved in vesicular transport; overexpression leads to accumulation of Golgi-like cisternae with budding vesicles
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPT10 YBR264C
CCGACAAAATCTGTAAAAACGTCATCATCACCTCTGGCCAGCGACTTGGCAATGATATCA
CATGCTTGTTTGCATGGGATAGCGTCTGAGGGGCCTTCGATCAACTTTGTAATTTCGGGT
TTCGTTAGCTGCTCTACAGTGAAACCTTCGCTTTCAAAATTACCAGGATAAACACAACTG
ATACGGAAGTTCGTCAGTTCTTGTCTTAAGATTGCTACCAGTGATTTGATTGCAGCTTTT
GCAGGCGCATACTGGGAATAGCCCACAAATGGGTAAAGCGCGGTGGCACTAGAAAAGATG
ATGAGGTGGTGTTCCTTGGTTTGCTCTGCAAGGGCAATCTGATGTGCCACGTTCAAAGTT
GTTTTATAGTTGATGTCCATACCCAAGTTCAACTCATGTCCGCTTAGCCCACGAAATAAC
TTAGGAACAGCCCCCCCTGCACAGCATAACGTTTGTGTAGGGAGTAAATCCAAGTCTCTC
AGGGCATTGAACAAACATTCCACGGATTCGTAGCAGGACAAGTCGCATGGGTAGTAAAAT
AACCGTTGCTCAAGGTCCAAGGGCGCAGCCAACTTATGTTGCACTTGGCCCTCGTCAGTG
GTTTCCCTTCTCAGGTGAGCTTCAATCCTAATTTCGTTGCATGTGTCCAGCAGTCTAGCC
TCTGACCTACTGACGATAATAATCTTTGTGTTTTCAGCCTCATTATAATATTTTTTGGCG
AATTCCTTTCCAAGACCTTGTGAACCACCAGTGATCAACACAACTTGGTCTTCTAACGTA
AACTTCATTACCTACAAAAGATTATACCGATAACTTCTTTTCTTGAGGCAATCTTATTTA
ATCGCTTCCAGTAAATGCAGAGAAACTCCTCTGCATTTTTCATTTTTTTGTTTTTTTTTT
GTCGTTTATTGTTTTTTAGCCTTACGTTTCACGTTAAGGAACAATGATAGTAAAATTACT
CCAGGAAATACAAGTAGCACAAAATACGGAGGAATACGAT
Chr coordinates Chr II from 738369-737770
w3c xhtml validator w3c css validator