Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SDH8
Systematic Name YBR269C
Alias FMP21
Strain S288c
Description Protein required for assembly of succinate dehydrogenase; interacts with flavinylated Sdh1p and may function as a chaperone for free Sdh1p, protecting its FAD cofactor from redox reactions before assembly of the complex; soluble protein of the mitochondrial matrix; respiratory defect of null mutant is functionally complemented by Drosophila and human orthologs
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SDH8 YBR269C
AACAACAACCCTAATGATACAGCTCTATCGCTGATCCAAGATGATGCTTTCGACGCGACT
AATGTTTCTTTACTACATGATTTACTGAAAAACTTGCCATCCTTGATAGCAAACTATAAA
AGCTTCACCGTACAGGAGTTATTTGTTCTGGAGGGGAATATCTGGGGTATATACTGCAGC
ATAGTTGTGGAGCTATTTAAAAACAAGAGGGTATGGCAATTGCCAGCAAAAATAGAAGAT
ATTGACCGGCTGCTGGAATTTTATATCACTTTGAAAACACAAACCAAGGCTGCCGTAACG
CACTCAAGGTTTTTGGCCGAAATCGAGGAATTCATTACCACTTCACTTTACATTTTAGAG
AACCAGATTGTGTTCAATTATGCCAATGAGGATACCGTAAATACGGCTTTGAAAAGAGTC
GGCATAATCTGGAAGGTGTTTTACCAACAGGTTTACTACGACATGATGGCAGTGTTACTG
CCCTTCGAGAAAAGCTTCCAAAAAAATAGTAACTACTGGCTTGACGGATATCTATCTGAA
CCTTCAAGGTACGCACCGTCAATTGATGTCCTTTTATTAAAGTGTTTTAGAGACTCCATC
ATTCTTCCGTATTACGAAAGCTTCCTACATACAAATGACGGTGCCAGTAAGAGTTTTCAA
AGATATATTTTCAGCGAGGAAGAACAGAACGGCGTCACAGAGGAAGATAAACTGACGCTG
CTGCAGTGTTTTGGGATCCTGAATACCATAAAAGGTAACAGCAGAAACCAAAGAATTATT
GGTGAACTTCTTGAGGGCATACGCATGAGTATATAATTAAATATTTTATTTAGTAATATA
CAATAGTGGCATATAGATAGGTGTATTTCCTTTTTCTTGTTCCAAGAATCCGGAAAAACA
GATGCTCTTTTCCGCCCTATAAAGGGGCCAATGGGGAAAGTGCAGATCATATTAACTTGC
TAAAGAGTCAGAAAGAACCAAATAATAAAAAGAAGAACTA
Chr coordinates Chr II from 742576-742160
w3c xhtml validator w3c css validator