Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PAF1
Systematic Name YBR279W
Strain S288c
Description Component of the Paf1p complex; binds to and modulates the activity of RNA polymerases I and II; required for expression of a subset of genes, including cell cycle-regulated genes; homolog of human PD2/hPAF1; involved in transcription elongation as demonstrated by the G-less-based run-on (GLRO) assay
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PAF1 YBR279W
ATAAAAACAAGCAAGGGTCAACCGTGTTGCAAAAAAAATGTCCAACTTAGTTAAAGAAAA
AGCACCTGTCTTTCCTATATCTAAAGTAAAGAAGATTGCCAAATGCGACCCCGAATACGT
AATTACATCTAATGTAGCTATATCAGCGACCGCATTCGCTGCTGAGTTATTTGTACAGAA
TCTCGTCGAAGAATCGCTGGTCTTAGCACAACTGAATTCGAAAGGAAAGACAAGCCTACG
ATTAAGCCTAAATTCTATAGAAGAATGTGTCGAAAAAAGAGATAATTTCAGGTTTCTAGA
GGATGCCATTAAACAACTGAAGAAGAATAGCGCACTCGACAAGAAGAGAGAACTAAACAT
GCAACCGGGTCGGAGCGATCAAGAGGTTGTTATAGAAGAGCCTGAATTGCATGAGGATGA
TGGTGTAGAGGAAGAAGAAGAAGAAGACGAGGTATCCGAAGAAGAAGAGCCCGTACACAA
TGAAGAACTTCTTGATGATAGTAAAGATCAACAAAATGATAAATCCACGCGCAGTGTGGC
AAGCTTGCTGTCGAGATTCCAGTATAAATCCGCACTAGACGTAGGAGAACACTCCGACTC
TTCTGATATCGAAGTTGACCATACGAAAAGCACCGATCCTTAGTGTTGTTGCTATTATTG
CTATGTAATTACTATTCGATGCAATATGTTATACATATACATACACGCAATGAGAACCCT
AACCTTGAACTTACTATTTTAAAAGGACATCTCGAAAAAGCTTAGGGATAATTAATATTT
TGTAGGTTAGAGCTGTTATGTAGGGAAGAAAAACAAGGGCTTTAAAATAATAATCACATT
ACACGAATAACTTAATTTGTCTTTCTGAAATGGAAAAAGAAAAAAATGACGACTGTAACA
TTGGATGAATTAATACTGTCATTATTGATACGTTGTTAATTATAGACAGAAATGTATTCA
GTACAATAGAACAGTGCTCATAATAGTATAAAGGGTCACA
Chr coordinates Chr II from 761257-762594
w3c xhtml validator w3c css validator