Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HMLALPHA2
Systematic Name YCL067C
Alias ALPHA2
Strain S288c
Description Silenced copy of ALPHA2 at HML; homeobox-domain protein that associates with Mcm1p in haploid cells to repress a-specific gene expression and interacts with a1p in diploid cells to repress haploid-specific gene expression
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HMLALPHA2 YCL067C
TTTGATTGTTTGCTTGAGTCTGAGTAATATCATATTTTATACAAATACATAGACATAAAC
AAAAGAGGCAAGTAGATAAGGGTATAGCCATATGAGTGTATAAACAAACATTGGGAACAA
GAGCAAGACGATGGGGAGTTTCAAATAGGATAGCTATACTGACAACATTCAGTACTCGAA
AGATAAACAACCTCCGCCACGACCACACTCTATAAGGCCAAATGTACAAACACATCTTCC
CAATATCCGTCACCACGTACTTCAGCATAATTATTCGTCAACCACTCTACAAAACCAAAA
CCAGGGTTTATAAAATTATACTGTTGCGCGAAGTAGTCCCATATTCCGTGCTGCATTTTG
TCCGCGTGCCATTCTTCAGCGAGCAGAGAAGACAAGACATTTTGTTTTACACCGGAGCCA
AACTGTGAGTAATATGCTCTAAAAGCCATAAATGAGTTTAAATATTTCTTTGAAGATTTT
ATAGATGTCTTATTGAACTGTCGAAACTGAGTATTTTGACTTCCAGACGCTATCCTGTGA
ATTTGGATTTTATTTAAAAATCGAGAGGAAGGAACAGGAATCTGGATATCTTTCTTGAGT
GGTCGAATAATATTGAAGCAGCTTGGCCTCACATGCTCAGCTAGACGTTTTTCTTTCAGC
TTTTTTGAAACCGCTGTGTTTCTGTATGATTTGGATGCTTTGTTCTTAATTTTGAAAGCA
GGCTTCGAAGTAAACATATTGTGAATGTCGTCTATTAAGTTATTATATATGGTTGATACA
TTTCATAAAAAGTGAAGGTTAAAAGAAGTAGTTAAGAGTTTAAGTTGTTTCATATGATGT
ACTTTTCTACATTGGGAAGCAATAAATTGCATCCCAAACAAAACCCAGACATCATTAATG
TTTTGAAACATAAAATGTTGGAACTTAAAAATATATATAAAGGAGAGATTGAAATCAGCT
TAGAAGTGGGCAAGAAAAAAAGGAAGATAAGCAAGAAAAA
Chr coordinates Chr III from 13018-12386
w3c xhtml validator w3c css validator