Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AHC2
Systematic Name YCR082W
Strain S288c
Description Component of the ADA histone acetyltransferase complex; Ach2p and Ach1p are unique to the ADA complex and not shared with the related SAGA and SLIK complexes; may tether Ach1p to the complex
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AHC2 YCR082W
CGTTGTGGTGATCGAGATTATAACGTCATTATCGATGAGGTTTCAAAGAGAAACTTCTGG
TATGATAGTTATTTCCATGGAGAACTATCATTTACTAATAAAGATCATAAGACAATTAAG
TGAACTGAACGAAGGAAATTTATCTAAGAGAGAAATCCAAATAGATGCCGTCTTGAAAAT
TTTTAGCTTTCATCAGGATTCCATTTTCCAACGCATCATCGCTGATTTATCAGCTGATAA
ACCCACAAGTCCATTCATTGATAGCATATGCAAGCTGTTTGATAAAATATCATTTAATTT
AAGATTGAAGCTGTTCTTGTACGAAATTTTGTCTTCATTGAAATCATTCGCCATCTATTC
ATCCACAATTGATGCCCCAGCATTCCACACAAGCGGTAAGGTCGAACTACCGAAGAAATT
GCTGAACTTACCACCATTCCAAGTGTCCTCTTTCGTTAAGGAAACAAAACTTCATAGTGG
CGACTACGGGGAAGAAGAAGATGCAGACCAAGAAGAATCGTTTAGTTTAAATTTAGGAAT
CGGCATAGTTGAAATAGCGCACGAAAACGAACAGAAATGGCTCATTTATGACAAGAAAGA
TCATAAATATGTCTGCACATTTTCCATGGAGCCGTACCACTTCATCTCCAACTATAATAC
CAAGTACACAGATGACATGGCTACAGGCAGTAATGATACGACTGCGTTTAACGATTCCTG
TGTAAACCTGAGTCTTTTTGATGCTCGGTTTGAGAGGAAAAATCCACATTGATCTCAGAA
TATATCCAAATGGATAAATTATAAATTTACCAATAACAGTAATTATGTGTCAGTTTTAAT
ACCCAACCAATTGATTCCTCTAAATGATACCGTACCAAATGACATGTTTGCCACCGATTA
TAAAACTGGGGTTTATGAGCGATGGTTAAGGAGGATTAAGACAAAGTGCTCATCCGCTTA
CAAGATCAGTACTAGCGTGTACCAGTCTATTTAAACTGGA
Chr coordinates Chr III from 258883-259269
w3c xhtml validator w3c css validator