Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCR099C
Systematic Name YCR099C
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCR099C YCR099C
AAAGATAAGATTGTTACTCAATACAAGATATTGAAGTCATATGTGGTCGTTTTAACGCAA
GATGACGGGCATAACGAGATGTCATCTACGGACATCTGGATATCCAATGATGCATCTACT
TTTCAAAAGGCACAGCTGCCTACTCAATTACGGCACGTCAAAGTGATTAAAATTCGTGAA
GATTCTATCGGAAGGATCATCCTTCTTATATCGACAGAAATCACAAATGAGGAAAATGCT
GATCCAGATCTCTCAGAGATTTTCATATCAGATTCGCAAGGGTTGAAATTCTCACCTGTT
GAATGGACACCAAACCATCAGTTTGGAAATTTTAGGCTCACTTTTCCTGATTTCTTGAAA
GGGACAATATTTGGATCGTTTCATCCTTCCATTGACTATTCTAATCACCAAGTAAACTAT
ACTGAAAATATAGCCGGAGGAGAAACCAAAATATCCGTTGATAACGGCCTCACATGGTCA
AATTTGAAAGTTGTTGATGAAGAAAATGCCGATTCGTTCGGCTGTGATATCACTAGGCCT
GAGAGATGTTCACTTCAGGGTTATTTTTACAATCTAAAACTTTCAAATCCTTCTGCTGGG
ATCATATTAATGACAGGTTCTGTTGGCGATGACAATGAATTCGATCGGAAGGACCGAAAA
ACTTTCATTTCTAGAGACGGTGGTCTAACATGGAGGGTGGCCCATAATTCTTCTGGATTA
TATGCTACTGGTGATCTGGGAAATATTATTGTATATATCCCGTCTCCTTCATATAAAGAT
GGTGATGTACAATCCAAACTTTATTTTTCCTTGGACCAAGGTAGAACATGGAATCAATAT
GAGCTTGTTGACGCTTTATTTTATATCCATCCATTAGAGTTGATTAATACAACGCCAGAT
GGATCAGGCTCAAAATTTATTTTAAGCGGACATCTCATTACTACGGCTAGTCAAGAAGGA
AACAACACCAACATCTCATATATTGCAAGAAGTGTCCTGT
Chr coordinates Chr III from 301299-300832
w3c xhtml validator w3c css validator