Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDL009C
Systematic Name YDL009C
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the uncharacterized ORF YDL010W; YDL009C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDL009C YDL009C
TAAGTATGCAACGATACCGCTGTCATCGTTAGCATGATTAGTACACTGTTGTTCTTTTTC
AATCTAACAACCTTAACTTCAGTTCCGGCTACAGTACATCTATTCAACGATTGGAAAAGA
AAATTTTTTTATCTTTAGCTGCAACAAGAAAAAATCAATATTAAATTTTCATTTAAGTAT
ACAGAATGTTAACAGCGTTCACAAGAAAAGAACCGTATGGAAATATAGCTAATTGTGATT
TCTAAGTTTCTTTTTTATCGTAACAAAAAGTCTTCGTCCAGGATGGTATCAACTTGCTGT
CTACCGATTGGGTTATCGGTGTTTTGCCTTATTGGTTCATCAAAGTCCACAAACTCTTCT
GCGACGCCCTCCTCTATCATTTCTTCTCTTCTTCTTGAAACTATTTCAACGAACTTTTGG
ACATGAGCGTCATTAATTGCTAGACCCTTCTGTAGCTGGAAAGTTTGCCTACACATCGGA
CACAGTCCTTTTGAGGTTGGTGTATCAAGCCAACGGTATATACAATGATCATGGAAGTTA
TGATGACATAGCCCAATCACTAAAGGGCATTGATCGCCTGGAAATTTACAGCTTGGACAG
GTACCGTTATAACTGGCACGACAGATACCACAGACATCCTCGTCTTCATCATTGCCAATT
GGATCGTTATTGGCTGCGTCCTCATCAGATGTGCTAGGGATGTGCCATGACCAAGCAAAC
ACACTGTGCACTTCGTTTATTTTAACTTTCATATTTTTATAATCTGTATTGCCACTTTGC
TTGTTAAACTCTCCCGATATTGTACAAAGTTTTTGAAGAATGCATTATTTTTTTATCTGC
AGACACGGAAGATACAAAAGTTATCTCGGCAGCTTACCCTTTATATCGAATGCAGGCGTA
GACAAAAGTGCGTTGCATAACTTACCAAGGTGAAGTGCATGGACCAGCAAAGGATAGAAG
TTATTGTAAACATCGAAACCATAAACTTATATATGTATAT
Chr coordinates Chr IV from 433248-432925
w3c xhtml validator w3c css validator