Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDL012C
Systematic Name YDL012C
Strain S288c
Description Tail-anchored plasma membrane protein containing a conserved CYSTM module, possibly involved in response to stress; may contribute to non-homologous end-joining (NHEJ) based on ydl012c htz1 double null phenotype
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDL012C YDL012C
GGCATAGCAGCATATTCCCTGGAAGATCCTCCAGCCATATTGTCCATATTAGTACTAAAT
GCTTTAGAAGTTTCCTCTTTTATCTCTACCGTCAAGAAGTTCGCATTTTGCGCTACGAAA
AACACTAACAACAATAATAGCGTTGTAATGCTTAAAATTCTAGCATTTCTCTTATTGGAA
GGTATCATAATAAAATTGTTTCTATATTAAACCGCTAGGTTGCTAAGGTTTCGTCTTTTC
TATCTTACGATAATTTGCTTAAAAGTTCATTTAGAGAATAGATAGTGATCTTTCCCAGTA
TAATGTTTTCCCGATTTCGCGAACGCTCCGCCTCAGGCGCCCCGGGACGCGTCATGCGCG
TTCCAGAAAGTTAACTAACTGCTAGTGCATTCAATTTCTCAAGGCGTAGTATTTGGGATC
TATAAAGCCTTCGACATTAAGCACTATGCTTAAAAGCGAACAGCCTGCGCCACTACTTAA
GAGCGAATCTTGTGTGGAGGGATGACTAGGTCCAAAGAGGGAGAAAAGGATCTTGCGGAA
AAGTCAACAACACTAATCGGTAGCTGAGTCTGTCAGTGCATCCTTACTGGCTTACTATTT
TCATTCATGCTGCAAGTAGATTATCCTCTAGTTAAATTAAACGCGGATGAACTACGCCAT
TAAATCCATCATAAGAAACTAATTACTACTTTTAGGAAATTAGCCAACTAAAAACTGCTG
AAACGCCACATTTCACATAAAACCCCACGGAGCAGTAATGGGAGATCTTAAGCTCAGCCC
AGTACATATGTCCATCAGCCTTGAATAGCCACGGTGAGTTCTCGAAGCTTCCTTCCACCT
AGTCCAGAATATTTCTTGGTAAATGGCTCGAAGTTTTCGTATTAAACGATGCTATCAGCG
GCATCGTGAAATATTGAAATATAAAAAGTATTTACGCAACCGAAAAGGATATTAAGACAA
ACCCATACAATAGCCCATAAACCAAGCAAATACACATCTC
Chr coordinates Chr IV from 431386-431108,431517-431473
w3c xhtml validator w3c css validator