Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NOP1
Systematic Name YDL014W
Alias LOT3
Strain S288c
Description Nucleolar protein, component of the small subunit processome complex, which is required for processing of pre-18S rRNA; has similarity to mammalian fibrillarin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NOP1 YDL014W
ACTTAGCATTCCCAAAGGGGAAGCCGTAGCCAAAGTAACCGAATGAAATGAGACCGCTTA
GAACCCAGTAATGGAAACAATTTTTGAACAGGTTGAAAATTGGCATAGTAGCTAAAGAGA
ATTGGTGAACAAATAAGGTTTCAAATAATCTCTTTCCATAATGTCCTAAAATTAAAAAAT
ATGCAACCCTGTTTAAAAATGGATTATAGTCGGAGCTAGCACTGTGCCATCTATCAACAA
CTGTGGGAATGGTAGATAGATAATAAAAAAGGGAGTGAACCAAGACTGGACCCAAATACT
CACAAAAGAAGACTAATCTCCATGAAATTTGGGGACCCAAATCTTTGATGAAGAATTCCA
TTGAGTCATCAGCCTCTTCTTGAAAAAACGATTCTGAAATAACCGGAACTTGTTTAGATT
CCTTTTTGTAGGTTAATCTTATCCTGTACTTGCTGATATTGTGGTTATTAGCAGAGATTT
TTTTCAAAACATCATCTAAAGTAGGCTTTTTGGATAAGTCAATTTCAGTGTCCCTTAACC
CTTTAGAGCGGCTTTTTATGGTGATAGGCATTTTCAAATTAAATTCAAAATATGTATCTC
TCTCAAATAGCTCAATTGGTTTCTAGATAGCTAAATAGAATATAATCTTACTGTCCTCCG
TTCTGTAAAATTCACGCTCTTAGTCCCTTTTCATAATTCCTTAACTTTTTGCGTACAAAA
TGATATGTTTATTATATTTTTCTTTTTTTTTTTTCAAATTTTTTCTTTTTCTTGAAAAAT
TTTTCAAATTGGAAAGCTCATCTCTCTTGAATGTATAATACTTTCTTCCTCTAACTTTCA
AAAAGTTTTACATAGCCAAGAAGTTTTCCTTACATCGGTATACTACTGTTATATAAGTTA
TTCTTCGAGAAACAATTAGATATCATTCATCGGATAAATCTAAGTTGCCCATTGCTTTCA
ATAACTCCGATCAAATTAACTCAAATCAACTAAAACAGTA
Chr coordinates Chr IV from 427364-428347
w3c xhtml validator w3c css validator