Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPM2
Systematic Name YDL021W
Strain S288c
Description Nonfunctional homolog of Gpm1p phosphoglycerate mutase; if functional, would convert 3-phosphoglycerate to 2-phosphoglycerate in glycolysis; GPM2 has a paralog, GPM3, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPM2 YDL021W
AAGAACCTGCCGGACATGATTGAAGAATTAGATCTACATGAAGATTAGATTTATTGGAGA
AAGATAACATATCATACTTTCCCCCACTTTTTTCGAGGCTCTTCTATATCATATTCATAA
ATTAGCATTATGTCATTTCTCATAACTACTTTATCACGTTAGAAATTACTTATTATTATT
AAATTAATACAAAATTTAGTAACCAAATAAATATAAATAAATATGTATATTTAAATTTTA
AAAAAAAAATCCTATAGAGCAAAAGGATTTTCCATTATAATATTAGCTGTACACCTCTTC
CGCATTTTTTGAGGGTGGTTACAACACCACTCATTCAGAGGCTGTCGGCACAGTTGCTTC
TAGCATCTGGCGTCCGTATGTATGGGTGTATTTTAAATAATAAACAAAGTGCCACACCTT
CACCAATTATGTCTTTAAGAAATGGACAAGTTCCAAAGAGCTTGCCCAAGGCTCGACAAG
GATGTACTTTGGAATATCTATATTCAAGTACGTGGCGCGCATATGTTTGAGTGTGCACAC
AATAAAGGTTTTTAGATATTTTGCGGCGTCCTAAGAAAATAAGGGGTTTCTTAAAAAATA
ACAATAGCAAACAAAGTTCCTTACGATGATTTCAGATGTGAATAGCATGGTCATGATGAG
TATATACGTTTTTATAAATAATTAAAAGTTTTCCTCTTGTCTGTTTTTTTGTTGGCTCGT
GGTTGTTCTCGAAAAAGGAGAGTTTTCATTTTCGAAATAGGTGATTATCATCATGTTGTT
ATCACCCCACGACGAAGATAATACGGAGCTCACCGTTTTCTTTTTTTTTCCCTTTGGCTG
AAATTTCCCACCAGAACAAACGTGACAAAATTATCTTTGAATCCAAAGTAGCTTATATAT
ATACGTAGAAGTGTTTCGAGACACACATCCAAATACGAGGTTGTTCAATTTAAACCCAAG
AATACATAAAAAAAATATAGATATATTAACTTAGTAAACA
Chr coordinates Chr IV from 413953-414888
w3c xhtml validator w3c css validator