Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RTK1
Systematic Name YDL025C
Strain S288c
Description Putative protein kinase, potentially phosphorylated by Cdc28p; interacts with ribosome biogenesis factors, Cka2, Gus1 and Arc1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RTK1 YDL025C
TATGCGTCATTTGATTATTGTTGTTTTTTTTTTTTGTTTTTTTACTTTCATTACATCGCT
AAATATAATATAAAAGAGATGAACGGCTATTCTTTCTGAATATCGAAAGTTAAAACTCGG
ATAGAAAATTCACAAGAACATAAAAGAAAACTTCCGGATTTCAAAGGCGGTTCTGGTATT
GGGAAACTTCCACAACATATCTCAAATTCAAACTGAAAAGTCCTCAGTGTCTTTTATTCG
AAACTCCGGGAAAGCACTGCTTGAATGGATTAAGTAAACTTGAAATAAATTTTTTACTTC
TACAGCTAAAATGTGAAATATAGTGTCCGCTTCCACCAAAGGCGTTTATTTTCTCGAAAT
GAACCTGTGAATAACACAGCTGGCTCCAACTCAAACACTCAACTGCGTCATTTCTTATTC
GCTTTCCAAATCATGCATGATTTTTCTTTCTCTTGCCTGCAGTGCTCGTTTCACCGCTCG
CGTACTCGTCCATTCTTTGTCAGCGAAGAGGCTCTAACAGTGGAGAGCACATCTGGCAAG
TAAAATGATAGGTTGCGCAAGGGGGTAGGGGAATGACTAATAAAGCATTACTACCATCAT
ACCAAGTTCCCATTCATGTACACATAGTCTCTTTAATTGCCTTCTTGAATGGAGGCCAGT
AGATATTTGGAGAAGCTTTTCTTGCAGTTCGGGTAATATCGAACGGCGTACATCTATAAG
GGGAAAAGCTACTTCCGCTTCTCATATATCTATTTTGCAGTGTGACTCTTCCTGGCTTGC
TAAGTATTGTACCTGTTATGGGGCAAGCAAGATTTCTCATTGAAAAAAGATATAATACTT
ATTTGCAGCCAATAGTGACGGATTCTAGTGTTCTTCTTTTCCATAAGTTGATTACGCTAT
TCACCCAAACTGACTCTTTAGTGCGCTAATAAGCTGAGAGGATTTGAGAGGGAAAAAAAG
AGAGAAGGACAGAAAAGAGCAGCCTGAAATTCATAGCATA
Chr coordinates Chr IV from 407206-405344
w3c xhtml validator w3c css validator