Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARP2
Systematic Name YDL029W
Alias ACT2
Strain S288c
Description Essential component of the Arp2/3 complex, which is a highly conserved actin nucleation center required for the motility and integrity of actin patches; involved in endocytosis and membrane growth and polarity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARP2 YDL029W
CTGTAGGGGATCTCTTCGGTCCGAGGCAAAAGGTATCTATTGCCCTTTTTGTTCGAGGTG
GTTCAAGACATCTTCCGTTTTCGAAAGCCATTTAGTAGGGAAAATTCATAAGAAAAATGA
ATCTAAAAGAAGAAATTTTGTGTACTCTGAATATAAACTGCATCGGTATTTGAAATATTT
AAATGATGAATTTTCTCGAACGAGAAGTTTTGTTGAAAGAAAACTGGCATTTACTGCAAA
TGAAAGAATGGCAGAAATGGATATCTTAACACAGAAGTATGAAGCACCTGCATATGATTC
GACGGAAAAAGAGGGGGCCGAACAAGTGGATGGTGAGCAGAGAGATGGTCAACTGCAAGA
AGAGCACCTCTCTGGTAAATCGTTTGACATGCCATTGGGTCCGGATGGATTGCCTATGCC
ATACTGGCTATACAAACTGCATGGGCTTGACAGAGAGTATCGCTGCGAAATTTGTTCGAA
TAAAGTTTATAATGGGCGACGCACTTTTGAAAGACATTTCAACGAAGAAAGACATATTTA
TCACTTGCGATGCCTTGGTATCGAACCTTCTTCAGTATTCAAGGGCATAACCAAAATTAA
GGAGGCACAAGAGCTCTGGAAAAATATGCAGGGGCAGTCACAGTTGACATCTATTGCAGC
AGTTCCCCCAAAGCCTAATCCTTCACAACTAAAAGTTCCTACAGAATTAGAACTAGAAGA
AGAAGACGAAGAAGGAAATGTAATGAGTAAGAAGGTCTACGATGAACTTAAGAAGCAAGG
TTTGGTGTGAAATCTCTCTGTGATATGTATATTTGTTTGATAGATAGCAGTTGTATGTAT
TTATACTATTCTTAGTAATGACCTTATTACCCGTCTTGTAGAATTGAAAGGCGAAAAACA
ATTTGAGGACCCATATAATGGAAGAAAACGGACGTGAAAGTTAAATATACGTACCAGAAG
ACAAATCACAGTAATAAACTAACAAAACTATATAATAATA
Chr coordinates Chr IV from 399340-399361,399485-400638
w3c xhtml validator w3c css validator