Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRM7
Systematic Name YDL039C
Alias YDL038C
Strain S288c
Description Pheromone-regulated protein, predicted to have one transmembrane segment; promoter contains Gcn4p binding elements
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRM7 YDL039C
CATTACTACTTCATCCACTACTACTTCATCCACTACTACTTCATCCACTACTACTTCATC
CTCTACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATC
CTCTACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATC
CTCTACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATCCTCTACGAAAACTTC
CACTACTACGTCATCTACTGTGAAAAGCTCTTCCACTACATCCATTGATTTTACTACTTC
CGTTGACTCACATACTTCATCAAGCGTAGCCGATATTTATCGTTCAAGAACATCTACTGA
TGTCACCACATTAGCAGCTTCAACTAGTCCTTTCAGCAGTTTCACTTCAAGTGACTCTAG
TAGTTCAAGCGATGTAACCAGTTCAACCATTCAAACTACTTCTGTTGATCCAACCACTTA
AGTAGTAAGTTCAAGTTCAGAAGACCCAACTAGTTCAAGCGCTGTGACTACTTCAGTTGA
CCCAACTACTTCAGTTGACCCAAATACTTCAGCTGATCCAACTACCTCGACCGTTCAAAC
TACTTCTGTTGATCCAACTACTTCAGTTGACCCAACTAGTTCTATAGTCAGTTCTACTTC
AGTTGATCCAACTACTTCAGTTGACCCAACTACTTCAGCTGACCCAACTACCTCGACCGT
TCAAACTACTTCAGCTGATCCAACTACTTCCGTAGTCAGTTCAAGTTCAGCTGATCTAAG
TAGCTCTGTTATCAGTTCAAGTTCAGCAGACCCAACTAGTTCAAATGCTGTGACTACTTC
AATTAACCCAACTACTCCAGCTGATTCAACTACTTCGGCCGTTCAAACTAGCCCAGCTGA
TCCAAGTAGCTCTGTTACCATTTCTACTTCCACAGACTCTACATCTTCAATTGAGTATAC
TACATCGGATGATCCACACGCCTCATCAAGTTTAGCGGCT
Chr coordinates Chr IV from 384081-381985
w3c xhtml validator w3c css validator