Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KNH1
Systematic Name YDL049C
Strain S288c
Description Protein with similarity to Kre9p, which is involved in cell wall beta 1,6-glucan synthesis; overproduction suppresses growth defects of a kre9 null mutant; required for propionic acid resistance
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KNH1 YDL049C
GTACCCGCCCAAGACCAAGAAAGAAGATAGAGGTGTTGTGCCGGGGAAGTGCAAGCATTG
TGGACTGCAATTTCCGAACGTTGACGTCTGGCTAAATAAGCACGTGGGGAAAGGATGTGG
CTACTCATATCACTAAAACCAAAGTCATTCACCGACTCATACATACACACACATACATAC
ATTTATTTATTTATGCCCTAATAATACACATCATTTCTGCGTAAATTATTGTTACGCTGC
CCTACGTTATTAATCTAGATTCTTGTTTTCTCTCTGTGTCTCGTTTCTCTTTTTAGGCAT
GAAGCGAAAAAATCAACAACCGCTATTGACAGGAAGCAAGCTGGCATGAGCCGTTTTTTT
TACTTTTTTTGATTTTACCAGAAGGGCGTTGAGACCTGCATCAGCCGTTTGCGGATAGGT
TATGCCAGTGATGAAGCACCTGATTCAACTGCCGGCTCTCCGATTGGTCTCCGATCGTTT
AGTTCCTTATATTGTACACTATTTCAGCTGTACAAGCCTAGGCCCGAATCGAATTATAAG
TCCGTCCGGCTCAAGTCATGGACTCATTATCGATTCGTCTTTTTTTAGCTGCCCCCACGT
TATCTCTTCTTTTTTTTTTCTCTGCATCGCGGCGAGTCCCTTGAAAGGGTCGCGAACCTT
CGAAGCAGCACTTCTTTTTTTCACATGAGAATGTAGTCCATTGCGTAAATCCAGTCTTTG
CGGCTTTCCCTTCTTCCTCATCATATTGTTGACCAACTCCAACAGAAAAGCACATTTCCT
CTTCACCAATTTTCTTCTTTCTTTTTTGAAAGTACGAACATGTAAGGGACATTGGACATT
ATGTGCTCGTTCATGTATAATATTACATGAGGTAGTTAGTTACGTAAATTTATAAAAACG
TATCGATGAAAGTTGCACAGAAGTAAAAAGTAAAGTATACAAGTATTACGTCGACTTCTT
AGGTAGGTAACAATAATAAAAAATCAATTACGTAAAACGT
Chr coordinates Chr IV from 365874-365068
w3c xhtml validator w3c css validator