Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YET3
Systematic Name YDL072C
Strain S288c
Description Protein of unknown function; YET3 null mutant decreases the level of secreted invertase; homolog of human BAP31 protein; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YET3 YDL072C
GGTATTTACTTTGGTGTGGTGGTAGTTCCTCCGCTTCCATTTCAGCTTCCAACGCCGGCT
CTGTTTCCCGTTCTAGGCCCAAAGGGTGCTCGGGAAAACTTTCCGGAGTGGATGCATTAC
TAATGGAAATGGGAGACAAAGTTTGGTGGGCGTGGGATGAAGAATTCAGGTTAGTGATAC
CGCTGCTCGCAAGTTTGTAATTTTCCTCGTGTCCATAGTGGAAGATATCCCTGAAGTGGG
GTCCATCGTCGATACTTACCGCGCTGACATTACCGCTATCGTCACCGACGCCGACATTGA
TATTGTTTTTGTTACTACTACTCTCGCTGCTGCTGTTGCTGCTCCTGCTATTTGCAGTAG
CACTCTGTGGTGCTGCCAGTAAAGCAGAATGTGCGTGTCTTGTATCCATGTTAGTACGAG
ACATAGCCGCCGAGGTTTATTTCGCTCAATCTGTTTGTTTCAGTTTTTCCGCGTTCTCTC
TTTTTCGCTCTTTTCTGGCTACCGCGCCCGCCTTATATATAAAATCTCTTCCGAATAACA
AAGTGGCCGAAACAAGCGCCAACGTCGACCATTTTGCCACCGTGTCACTGTGCACGAGCA
ACGAAAAACTGGCGTTGGTTGCGCCTCACGAATTGCTTGAGCCTCTTCCCAATATCATCG
CGCATTTATTTGAGTCATTCTCTGCCGCTTTATTATTAAAAGTCTGTGTGCTATCAAAAT
GCTCTTGCTCCTGTTCACCCTCTATGCGTAAACACTTGCGCGTTTCTCCCTTTCTCTTTT
AGCGTTGTTGACGTTGCACTCTTTTTTCGCCTCTTTCTTTTTTTAGCTAGAGGGTCACCC
TGCCTGCTTCACTCCATTAAGGGGAAGAAGAGTGGAAAAGTGCCGTATATAACAATGGTA
TATAGCAAATCCCGATTTAGTAGGAAGATAGAATAGTGAGCTCTTCCAAGGTAACCACGT
CACATTATACTCATAACCATAGAATTCACAGAATTGAATC
Chr coordinates Chr IV from 330447-329836
w3c xhtml validator w3c css validator