Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AHK1
Systematic Name YDL073W
Strain S288c
Description Putative protein of unknown function; YDL073W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AHK1 YDL073W
ATCATACTTGCGAATTATATTTGTATAATATTCCTTCAAAGCAGAAATCTCCTCTGTCAA
TTGCGAATTTTCATAAAAGAGCTCCTCTTTACTTTTCCGCAAGTTTTTTAACTCCGTTGT
TAATTCTTGAATATGATCCGAAGCATTACTATTAGTATTACTATCTGTCGTGTTTGGCTT
CCCATATTTAGTCAGTAGCTTCATGAAAGAATCACTGCGCTGAACTATCAACGTCTCATC
GCCTTGGGCTATTTCCCTACATAGTTGCTTCTCGTTGGCGTCTGTGCAGAATGTTTCGAT
AAACCTAGCTAAAGTTACTATCAGCGCCATAATATTTGCCAACTTGCGGGAAACATCTAT
GCACTCCCTTCTTGAAAGTTCATATTGCTTTCGCAAGGCTTCAAAGTCGACTCTTCGACG
ATTTATACATCTAAACAAAGCTTCTTTTTGAAACGCTATCACATCAGATTGAGTAAGCGG
TTCACTAGGATCGCTTAATTCTAGCTTGATCTTCTTAGTAGCAGGCTCGGCCGTCATATC
TGATTATTATCAGCTAGCACGATTAGCATAAAAACGGTGAAAGCCCTTTCTATCTCTGTT
AAAAACCTTGGGGCGCTCTCTGTTAGTTTACCGTTCAAACAACATCCATCCAACTTTTTT
TAATCTTCTTCTTTTTTGTTTTTTCGCCTTCTTTAAGAAAGTTTCGTTGGATGTGATTAT
AATCACGTGATCAAATGCTTTTGTCACTTTTATATAATAACGATGGTTTGATCAAAGTAC
GATCAGTTGGTGCTTCATTTCAAAGTTAGAAGACATCCTTAGTGCCTATTGTCGATCTGC
TCTTTCTTTTTGAATCCACTGAAATTAACGATCTCAGAATTTCACCAGTGATTTTCCCAA
TATTATCTTTCGTGGGTAGAGAAACAATTCTGAACTCGATTGTGCTTCGTATGCTATATA
CGCATTGTTGTAGCACTAAAGATCATATTGCTCATTAAGC
Chr coordinates Chr IV from 326613-329567
w3c xhtml validator w3c css validator