Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRK1
Systematic Name YDL079C
Strain S288c
Description Glycogen synthase kinase 3 (GSK-3) homolog; one of four GSK-3 homologs in S. cerevisiae that function to activate Msn2p-dependent transcription of stress responsive genes and that function in protein degradation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRK1 YDL079C
ATAGGGTCCAGTTCGGAGGTGATGAAATTGTCAAAGCTAAACAGGGCGCCGGTTCCGCCA
CGTTGTCCATGGCGTTCGCGGGGGCCAAGTTTGCTGAAGAAGTTTTGAGGAGCTTCCATA
ATGAGAAACCAGAAACGGAGTCACTTTCCGCATTCGTTTATTTACCAGGCTTAAAAAACG
GTAAGAAAGCGCAGCAATTAGTTGGCGACAACTCTATTGAGTATTTTTCCTTGCCAATTG
TTTTGAGAAATGGTAGCGTAGTATCCATCGATACCAGTGTTCTGGAAAAACTGTCTCCGA
GAGAGGAACAACTCGTTAATACTGCGGTCAAAGAGCTACGCAAGAATATTGAAAAAGGCA
AGAGTTTCATCCTAGACTCTTCCAAGCTATGAGCTACTTCAATTTTTATATTTTTCTTAA
CTCTATACTCCTTTGTATCTTGACTCATATCGTTGTATAATGTTTCGCTTACTATGATAT
TTTATACTCAAGTAAATTGAAGGAAAGGAAACCATATCCTCCTAGTGGCTGCGCTGCACT
ACGCCGCTATGACCAATTCCGCTATGACCAGTTTACCTTTACCACACTCACTCCACGATG
TTTTAAGCGTTCCTTGTCAAATATGCACCATCTCGTGATTTTTCAAAGATTGGTAAAGGA
ACATGAAAAAAAAAAAGCGGGGGGGTGGGGAAAATAGAGTTGATTCTGCAAAAGAGAAAG
ACAAAGGCCGCCCCTGGGAGCAAAGTCGTCCGATGAGGAACTAACCAGGGGCAGCATTAT
CCGTTAGGATCTACCGGAGAGCTGTTCCAGCGGCGGATCTGAGAAAGATTGGTTCTCCTT
TTGTCGCTATATCTTGCAACTTAAATAAGCATTCTCTAAAAAATACTGGTGCTATAAGAA
CCCTGCTGCATACAAGTATTTCCGTTTCTACCATACTGCGGGGAAGGGACTTGAAAATAA
TCTCAAGATTGAAGAGGTGAAAATTGTAAAATAGTCTACT
Chr coordinates Chr IV from 314044-312951,314748-314337
w3c xhtml validator w3c css validator