Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPP1A
Systematic Name YDL081C
Alias P1A, RPLA1
Strain S288c
Description Ribosomal stalk protein P1 alpha, involved in the interaction between translational elongation factors and the ribosome; accumulation of P1 in the cytoplasm is regulated by phosphorylation and interaction with the P2 stalk component
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPP1A YDL081C
AACTAAACATAGAGTTATTCTGTTTATGGGTGACGGTGCTTTCCAATTGACAGTTCAAGA
ATTATCCACAATTGTTAAGTGGGGATTGACACCTTATATTTTTGTGATGAATAACCAAGG
TTACTCTGTGGACAGGTTTTTGCATCACAGGTCAGATGCTAGTTATTACGATATCCAACC
TTGGAACTACTTGGGATTATTGCGAGTATTTGGTTGCACGAACTACGAAACGAAAAAAAT
TATTACTGTTGGAGAATTCAGATCCATGATCAGTGACCCAAACTTTGCGACCAATGACAA
AATTCGGATGATAGAGATTATGCTACCACCAAGGGATGTTCCACAGGCTCTGCTTGACAG
GTGGGTGGTAGAAAAAGAACAGAGCAAACAAGTGCAAGAGGAGAACGAAAATTCTAGCGC
AGTAAATACGCCAACTCCAGAATTCCAACCACTTCTAAAAAAAAATCAAGTTGGATACTG
ATCTGATCTCTCCGCCCTACTACCAGGGACCCTCATGATTACCGCTCGAATGCGACGTTT
CCTGCCTCATAAAACTGGCTTGAAAATATTTATTCGCTGAACAGTAGCCTAGCTTATAAA
AATTTCATTTAATTAATGTAATATGAAAACTCACATGCCTTCTGTTTCTAAAATTGTCAC
AGCAAGAAATAACATTACCATACGTGATCTTATTAAACTCTAGTATCTTGTCTAATACTT
CATTTAAAAGAAGCCTTAACCCTGTAGCCTCATCTATGTCTGCTACATATCGTGAGGTAC
GAATATCGTAAGATGATACCACGCAACTTTGTAATGATTTTTTTTTTTTCATTTTTTAAA
GAATGCCTTTACATGGTATTTGAAAAAAATATCTTTATAAAGTTTGCGATCTCTTCTGTT
CTGAATAATTTTTAGTAAAAGAAATCAAAAGAATAAAGAAATAGTCCGCTTTGTCCAATA
CAACAGCTTAAACCGATTATCTCTAAAATAACAAGAAGAA
Chr coordinates Chr IV from 310122-309802
w3c xhtml validator w3c css validator