Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL13A
Systematic Name YDL082W
Alias eL13, L13A, L13e
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl13Bp; not essential for viability; has similarity to rat L13 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL13A YDL082W
AAGGGTGAAACAAGTGAGGTACCCTGGCACTTCCTCTTTGGAGCATTCTGTTCAAAATTC
ATTGCAAGGGGAGCGAATGAATAAATAAGACCGCAAAAGACGCTCATTACTTTACTCCAC
AGAGAAATTAAGTATAATATTTTCCCACACAATTTATTGGTTATTTCTACTCGGTCTTTA
ACGTGTGAAATGGTGATCCGTTGTTCTAAAACTATGATTCGCATCTAGTGCTTGCCCCAC
CCGTCTTATTCAGGTGATATGGTTCTTAAATTGAAATTATCTCACTGCATGGTTTCAATA
TCCCTCACAAATTCGTGACATCGTTTAAATTATTTAACATACTTGGACACTTGGGACGGC
AGACATCTTGTTGCTTATTCTCTTGCTGTATTTTTCGAAACACTGCTAAATAAAAAGGTA
TATATTAAATAGTCTACTGCGTAACCTATACATTTTACATGGCATTTACTTTTGACTTTG
CCAGTGTTACTCTCTGCGCTAGGATAATATTCGGTGGTATAGGCTCACGCGGCCTGGCCG
GAACGAACTGCTACCAGTTCTGTTTCCCTCAGCTAGAGGGAAACAGAGAGAATTTCCGCC
CAGGTCAAAGGCCACAGCATCCTTCTAGAGGAGGAGCGACAACCTAAGGAAAATTCAGTT
TTTCCTAGATCGCATACATTTTTCAACCACTTTTTTTCACAATGCATTATTTTTCAACAT
GTATGGGTGTTTTTTCTGAATATCAGACTCTTTTATGGAGTAAAACAAGCTATTAATATG
TGACCCATACATTTCCTGTTACATCCTTACATATATGCAGGCAATTTTTTGTAGTTAGAA
AATTTAATTTTTTTCTAGTCGGAATAATCACAGTAGAGGTGTGGAAATCTTGGAAAATTT
GAAATGATCGGATATTAGCTACTAATCCATTTAAGCTTGCAGCATTCTGTTCGAAGGGGT
TTGAGAAAAGCATAGTACAGCACAGCAGGAATCGTACACA
Chr coordinates Chr IV from 308424-308427,308793-309388
w3c xhtml validator w3c css validator