Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS16B
Systematic Name YDL083C
Alias rp61R, S16B, S9, uS9
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; identical to Rps16Ap and has similarity to E. coli S9 and rat S16 ribosomal proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS16B YDL083C
ATATAATTCAATTGGTAGATCCCATTTTAAAAATTGTTAGTATACAGAAAAGTGGACGTT
TCAATTAGACACCAAATTTATCATATTATCTAAGAAGACTCTAACAATGAGTTCAGCAAA
TAGTGGTACAAAGGTCCTGTCTCGAATTTGCTTGGCCATTACTATGACTGCTCAGTTATT
GTAAAAAGGAGAAAAATCTCATGATTTATTAGAAAATAACTTTAGCCTCTCTAGGTTCAT
CAATAACGTGTGTTGTATTATGCATGCCTTTGTGCACTAGTATAATCCTCTAAGGTAACA
AGCGAGCTTCTTTGGTCTATGAAATGACAAAAGTGATTTGAATTATTTTATAGTAGACAT
ACCCATTGTGTACGATTCCTGCTGTGCTGTACTATGCTTTTCTCAAACCCCTTCGAACAG
AATGCTGCAAGCTTAAATGGATTAGTAGCTAATATCCGATCATTTCAAATTTTCCAAGAT
TTCCACACCTCTACTGTGATTATTCCGACTAGAAAAAAATTAAATTTTCTAACTACAAAA
AATTGCCTGCATATATGTAAGGATGTAACAGGAAATGTATGGGTCACATATTAATAGCTT
GTTTTACTCCATAAAAGAGTCTGATATTCAGAAAAAACACCCATACATGTTGAAAAATAA
TGCATTGTGAAAAAAAGTGGTTGAAAAATGTATGCGATCTAGGAAAAACTGAATTTTCCT
TAGGTTGTCGCTCCTCCTCTAGAAGGATGCTGTGGCCTTTGACCTGGGCGGAAATTCTCT
CTGTTTCCCTCTAGCTGAGGGAAACAGAACTGGTAGCAGTTCGTTCCGGCCAGGCCGCGT
GAGCCTATACCACCGAATATTATCCTAGCGCAGAGAGTAACACTGGCAAAGTCAAAAGTA
AATGCCATGTAAAATGTATAGGTTACGCAGTAGACTATTTAATATATACCTTTTTATTTA
GCAGTGTTTCGAAAAATACAGCAAGAGAATAAGCAACAAG
Chr coordinates Chr IV from 307333-306926,307789-307766
w3c xhtml validator w3c css validator