Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NDE2
Systematic Name YDL085W
Alias NDH2
Strain S288c
Description Mitochondrial external NADH dehydrogenase, catalyzes the oxidation of cytosolic NADH; Nde1p and Nde2p are involved in providing the cytosolic NADH to the mitochondrial respiratory chain
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NDE2 YDL085W
ACACCTTTGGAGCACGTTTGTTAAGATCTTCACTCTGTACACGCTATATACTAAATAACA
ATAAGAAAAAGAAAAAGAAGCACAATATAGGAAAGCGTTCTAATTAACTAAAGAAAAAAA
AAAAATAAAAAAAAAATAAAAAAAAGGTAACTAAAAAGGACAAAAAACATAACAGCTGTT
TATAAAGTACTTTATACGTAAGAAACTACTGGCACTATTCATTCCAATAAAAGGACAGGT
ATAAAGTGTCTGCTTATCTTCTCGTCTTTTCGGCTTTTAACTTCTCAAGCTTTTCAGCCT
CTCTTCTAGCATCTGCGGCGGCCTGCTTTTGTCTCAAGATTTCGGCGTCTGACTCCATTC
TTTTCTTAGGATCACCACTCTTTTTCTGGTTCTTAGCCATGTCCTTTTGTTTTTTCAAGT
TTTTTTGTCTTGCCAAGTCTCTTTGATTACCTCTAGCCATTGTTAAAGATGTATCGTCTT
GCGACGTAATTTGTTGCTCTGTGTAGTATTGATCTTGTTGGTATTGCTAGAAATGCTTCA
GCAATACTGTATAAAATATGGAAACGTTGCCATGGCAAGACAAAAGAAGTGATCTTGAGT
GAAATAATAGAGCCCGGATGGCCGGGTAAATTCAACCGCTCGTACCGTTTATAATACGCA
TAAACGCCGAAAATGTCTCTATTTTAGTCATTCCCCAGAGTGCGGTATTGCGTACACCTG
TCATGCGTTCCTTAGTGCCGATAGATATACTAATATCGATGCGTCACAGTAGCAGATCAT
CTCTGACACTTGTTTCCCCATTTTTTTTTTTCATTTTTTAAAGGGTTTCTCTACAGCCTA
CAGGCCTCCCCTAATAAGTCAGCCCCTCCCTTTGGAGTGCGCTGTTGACCTGCGTATATA
AGAGGTATATCAGTGCCAGTAGGTAAACCCATCTTGCGGGGATTGTACCAGGAACATAGT
AGAAAGACAAAAACAACCACCGTACTTGCCATTCGTATAG
Chr coordinates Chr IV from 303211-304848
w3c xhtml validator w3c css validator