Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HNT1
Systematic Name YDL125C
Strain S288c
Description Adenosine 5'-monophosphoramidase; interacts physically and genetically with Kin28p, a CDK and TFIIK subunit, and genetically with CAK1; member of the histidine triad (HIT) superfamily of nucleotide-binding proteins and similar to Hint
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HNT1 YDL125C
GACATAGTCAGTGCCCATCTTCTTCAAAGCTAAATCTAGTCCATCCGCTGGGGAATCTGA
CATCTTGATTTGAGGTGAGTACTTGTCTGTCAAGAATATTGCATTTCTTGGTTTTTCGGT
GAGGCTAAGTGCCTTCCCAACTTCTGGATATGTTCTGTAGATCTCAGCAGCATCAATGTG
AATAATGCCAGGTAACTTCAGAGCATAAACAATCTGTTCGACCAAACTGTTCGAAAAGGT
AGCATCCGTTTCTTCGTTTTTATACCATCTAGTACCTGTCCCAATGATGGCGATTGCGGG
GATTTTATTTCCATTATTCAAGGTAAAGAACTGTTGGTGAAATGACATCTGTAAAAGTGT
TGTTAACTGACCTCCGTTTCTTTAGGGTAACACAACCGTTTACATGTGTATCCATATCCA
CGTAGTATCCGACTATCAATATATCCGTATATATATATATATATATATGGGATGAGCGTA
TGTGAGTGTTTTCGTAGATATTCAAAATACGAGTAAAGGAGATCCTAGGTGTGGATTAGT
AAGGGGAGTGTGGCAACTTCCTTTTTCCGGTTAATTCTCCGCGCTTTCGTTAGACTATTT
TGCAAGGACCCAAATAGGAGACGCATGGAGGCTTCTACAAAACAGCGTGCCGTTTTGATG
GCATGAGCAGGGGGCGCAAAGGAAACACCGGTAAATCGCGCAAGACCTTGTTGGCCACGT
AGCCTCAAAGGTTGAATTGACACTTGTCTACAGAACTTGAAAAGTACAAAAGGAGGTCAC
ATAAAACAGTAAGCTTGAGAAGCTTTAAGATATGGTGCGAATCGTTACAGAATATTCCTT
GCAGAAATAATGGCGGGTCCGTTCTCTTCTGAAGAAGTTACCGCCCTACTGAAGCATTGC
TGTACGATCGTGTAATGTGATGTGTGTTCGACTGGAAAGCGGAGAACATTATGAAGTAAA
AGGACAATCAGCACGCCTTCCAGACTTTTAAGAAACATTG
Chr coordinates Chr IV from 239398-239019,239606-239510
w3c xhtml validator w3c css validator