Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PCL2
Systematic Name YDL127W
Alias CLN4
Strain S288c
Description Cyclin, interacts with cyclin-dependent kinase Pho85p; member of the Pcl1,2-like subfamily, involved in the regulation of polarized growth and morphogenesis and progression through the cell cycle; localizes to sites of polarized cell growth; PCL2 has a paralog, PCL9, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PCL2 YDL127W
TTTATATTTTATCTTCTTCGTAATTCTATCGATGGACCAATACAAAGATGATTATGACTA
GCAAGTCATTATTATGATCGTTATATTATACATATTATGTTTACGCAACTAATTTTTATA
TCGAATTTTATCTGAAAAAAAGTTTTCAAAACCAACAAAATATTTTGTACACTCTTCGAA
ACTCAAATTCTGCACCATTTCCATTCTGATAAAAGGTTTAATATTTCGAAGCTTCTCAAC
TACAGCTCGTGTTCTTCTTGCAGCACATCAGCTGCTTTGCTGCACTGTTCAGGGTAACGT
TATTCATTACAACGAGAATATTTAGGAATTTTGCTCAAATTCATGGAGCTTCCTACATCA
TTGCACAACAGAATTTCGTTTTGTAGTATAGTTTATTAGAAACAAATGTGAATAGATCAT
GAGACGCGAAGCCCTATTTTAGCGGATTTTAGCCTTACATTTCTGAGTGAGAATGCCAGC
TGAAACACATTCTTGTTACATCTGTCACGGCATTCCAGCTGTAAAAAACCAGCAGATATC
GCATAAAAAAATGGCCAGCTATAGAATAAAATTAGCCCAGCTATATTTTTATAGCGTCTT
TTGATGACGCGAAAAGTAGACTTCGCGTAACACGAAAAATGCTGGTGCAGGTGGATTTTT
TTGGCAGATACTACGGTCAATTCTCCGCTCGAAGATTTTTATAGGCCTGGCTAGTTACCT
ATTTAGTGCAAATTGGGAAGAGATCTATTGTTCCCGCAGACACGCTAAGTGGTAGCTGTA
ACTTCGGAGACGTGTGAGACCTTCCTCAAACATGTTACAGGTTGATCGATTTACACATCT
AATGCAAGTTTAAGTGCTTCTTAAGTGTTTTTTTCTTTAGTCTTATAAGTTCTCCTTTCT
TTCACTTTATAATTCTCCTTTATAAAAGTAAGACCCGGTGCTAAACAACCTGATCCGACA
AGAGCAATTTCAATACGGCAGCAACTTTTTACTACAAAAG
Chr coordinates Chr IV from 234927-235853
w3c xhtml validator w3c css validator