Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VCX1
Systematic Name YDL128W
Alias HUM1, MNR1
Strain S288c
Description Vacuolar membrane antiporter with Ca2+/H+ and K+/H+ exchange activity, involved in control of cytosolic Ca2+ and K+ concentrations; has similarity to sodium/calcium exchangers, including the bovine Na+/Ca2+,K+ antiporter
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VCX1 YDL128W
ACTCATGGAAAACCAAAGTTCCAAAACTTCCTCTTCCTGCTTCCCGGCCGTCTTTGAATC
TTTCTCCCCAAAAAGTCCCAACGGGTACTGATAAAGTTGAGGAAGATACCAAAATTGACA
CATTGGAATTAGTAGAGAACAATAAACCGCATCCAAGGATGAGAAGAAGGAGTGACAATC
CAGCAACAAACGAATATGTGAGAGTTTTTCATTTGGAGAAAAAAGAACCTAAATCACGAA
AAAAATAGTATGCTAGAAAAAAATATTATTGAACGTCAATAATTTTTCTTTCTCATGGGA
CCAAACACATCATTTATTCTCTAATAATATTCTATTCTCTTTATTTCTGGTTTACTCTTT
TAAAATTCTCCAAAGAGAAATATCTCCTTCAATTCTTCAGTTACGAATTTATGTTTACTT
TTAACCTCTATCATACACCTTTAATCTAATGCCTCCAACTGTCTGTAATTTTAGTACAAC
TTAAAAGGGAAATTTTCCGAAAGTGTGAAAAAATTGGATTTTTTTTTCTCCTATTGAACT
CAATGGAAGCTATCAGTTTGGAGAGGGACAATTATTTTCCTTCTTGTTTTTTGCCAAGAG
AACAATATTGTAGTATTTAAGTTCTAATTTAATGTTATATATACTTATCTAATAGTTTTT
TTTTTTCAATTAGATTGTTTTCCTTACGACGTTAATCCCTTGTCATCCTCACTTACGAAC
TTCGATGAATATGACATACGTAATCGGGAATGTTTTGTAAACTAATTGACGTAGTTCCTT
TTTCGTAAACTGGACTGGACGGCTTGATCAAAATTCCCGAAAAATAAAAATTTCCCTCAC
GAGAATATGGAAATTACTATCGCCCAGCATTATTTTATCTCCTCAGAGAGTAAAAGAAGT
TTCCTCTTTCCTAAACTTAAAAAGCAGTCCTAAATATATAGTTGACTTCGACGCATATCA
TTCATCGGCTGCTGATAGCAAATAAAACAACATAGATACA
Chr coordinates Chr IV from 232652-233887
w3c xhtml validator w3c css validator