Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARF2
Systematic Name YDL137W
Strain S288c
Description ADP-ribosylation factor, GTPase of the Ras superfamily involved in regulation of coated formation vesicles in intracellular trafficking within the Golgi; functionally interchangeable with Arf1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARF2 YDL137W
ACTACAAGCAACGACACATCGTTCTCTCCATCACACAATAGCAATGCAAGAACGTCCTCT
AATTGGACGAGTGACCTCGCTAGTAAGCACAGCCAATACACTTCCCCCCAATAAAAACCA
ATAGCATCTTACGATCGTTCGAGGTCTTATAAACCGTTTTATATAAATTATTCTTATACA
CGCACTCTTGAGTTTCTTTTAACATTCCAACATGATAGACATAGAAAAGAATTATAGATA
ACACATAACATTACTCACAAGTAGCCCATGAGTTTGATTTTTCCTCGTTAATTCGGTGTC
AAGTGGAATACAAAATGGGTCAACTGATCATAACTATTACCCGGATAATCTACATCATGT
GGTACGTTAACGATGTATGGTTTCCTAAATCACCGGGTTCCAGATGCGGGTTGTTGTTGT
TCGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACCCTTACAGGAGATC
GGACGTGTGCGATTATTGTTACCTCGTCACCTGTTATCGGTTGAACTGTTTTAGCTCTTT
CCATTCCCTTTGTTAATAGTAGTTTAATTCTTCGGAAACTTTCTACGCAGACTCAAGTTG
CAATAGGCTAAAGATAAGGCAGACACTTTGTATGTAACGAGTTTCATTAGGAGGGATAGA
CGCACGACACTATCTGGTACTACGTGTTATATCATACCCAGAAGGAAGGACTCTCTCCAC
TGAACGGTGGGATGAGTTCCTAAAGGCGCCCCTTTATTTGATCAGGAAGCCGTATTGATT
ATCTAATAGGGCCTAGTTATCCTAATTGTGGGGAGTCGAGCAGTACGGCTCTGATGTTTT
TCGAACGAAGATAAGGAGTTGACATACAAAGTCAACAGAAGTTCTTCTTGTTAGCGTCTC
TGTGCTCAATATCTCTCTTTTTTTCTTTAAGTAGTAATTACTAACATCAGCCAACCAATA
GAGATAAAAAAAAAAGGAATTAAGATTTCATAGAGAAAAG
Chr coordinates Chr IV from 216529-217074
w3c xhtml validator w3c css validator