Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CCT4
Systematic Name YDL143W
Alias ANC2, TCP4
Strain S288c
Description Subunit of the cytosolic chaperonin Cct ring complex; related to Tcp1p, required for the assembly of actin and tubulins in vivo
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CCT4 YDL143W
GTGCTCTTCTTGTTAACCCCAAACTCCAGGCAACGCGGAACGTCTAGCCCCACAAGTGCC
GTGGATGTGTTGATAGCTGCATTGTAGAGCAACTTCTTCCACCGAGAGTAACGGACCCTA
GGGTCAAATTCGACAAAGTTTTGCCCCTCGTTGCTGTACATCCTGACGAAGTCGTTGGCA
GCCTGGATAGCAGCAGCGTCCTGTGGATCAAAAGCTCCACACGATAAGTGGTCCTGGCCC
ACTTGACTGATATGGCCTGACCCGATCTTAGTGGATCCGATTAACTGGATGCCAGAAAGC
ACCGTGTAACGATACTGCTCTCTGGGAAATTCCGCCCATATCTCCTTCTCAATATCGATT
CCGTTCTGTACCAGTAAAATGTGTGTCGTCAATTGCGGCCCATGTAGCTCTTTATTCTTC
TCAAGCACAGGTCTGATGATGTTGGACACCCTTGAATTAACGGGCCCATCTATGATGTTC
TTGGTAGTCACTACAATATAGTTGTATCCTTGGTTGTCTGCGGCAGAAGCAGCGTCCTCG
ACGCTGCTGTAAATATGGTGGGGTCTCCAACCTTCTAACCGGCCATAGTCACATGATTCG
ATTGTGTAGCCATGCTTCAATACCCTATCGTAGTCAGATCTGACTACCAAGGAAACGTCG
CTCTCCTTCTTAAGCCACAACGAAAGCGCAGTAATGACCCCAACGCCACCTGCCCCGATA
ACTAGTATTCTAGACATTTTCGACATTAGCTTATGCCAACTTGTATCCTGGCACCGGGAC
TGTAGTTTATGAGGTATATCAATATGTCCTAATTAAGGCTATATAATTTGGTATTACTAT
CACTTGCCACGGGGAAACTGAAATTTTTTTCGTTTCGCCACCAAGAAAGGCTAATTGAAT
ACAGTTCAAGAGGTTGATATAGCTAAGTGGGCATGAAGGTTATGAATTGTAATTGGAGGT
GCGGCAAGTGTGCAAGACGGGTAAAGGAGAGTATAGAACG
Chr coordinates Chr IV from 199996-201582
w3c xhtml validator w3c css validator