Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDL144C
Systematic Name YDL144C
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm and nucleus; YDL144C is not an essential gene.
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDL144C YDL144C
GGCTTTGGAGGAGATATTTGGAATTGAATTAACCCAATCTTTGCTTTTTCCTTTCTTGTC
GGACCACCAGCAGATTTGATTGCCGTTTGTGTCAAGACCACACCATCTATCATTTCTGTG
TCATCAATGGTACCACCAACTTTTTTGACCAGTCTGATATCGTTCAGGTCAACATTCTTA
GAGTTTTCATCAGATATCTTCAATACGGAGTCCACTGCCAAGGGCGCCAAAAACGAAGAG
TATTGAGACACAATCTTGGAACTCAAAGAAGTGGATGCAGCACGAACCAGCTGTTCTCTA
TCGCTCAACGAAACCTTATGGCACATTTCTAAAAGAATATCGACAGATCTCTTCGCAGCA
CTTTGAAAGGAGTCCGCAATGATGGTTGGATGGATGCCCTTGTTTAACAGCCTCTCAGCA
GCACCCAATAGAGCTCCGGTCAAGATCACCACAGAAGTGGTACCATCACCGGCTTCCGAG
TCCTGCGCGGCAGAAACCTCTACTAGCATTCTGGCCACCGGATGCAGAATGGCCATCTGT
TTTAGAATGGTGTGGCCATCATTAGAGATGATGATTTCTCCACGAGATGTCTTAATCATC
TTGTCCATACCCTTGGGACCCAATGAAGTACGGATGGCATCTGCAACAGAACGTGCAGCG
ATGATGTTGGCTTTGCGAACCTCTTGAGGTTTTTCCTTGTTCTTAAACGTGGCGTTAGAT
GGAACTTTAGCAGACATCGTTCTATACTCTCCTTTACCCGTCTTGCACACTTGCCGCACC
TCCAATTACAATTCATAACCTTCATGCCCACTTAGCTATATCAACCTCTTGAACTGTATT
CAATTAGCCTTTCTTGGTGGCGAAACGAAAAAAATTTCAGTTTCCCCGTGGCAAGTGATA
GTAATACCAAATTATATAGCCTTAATTAGGACATATTGATATACCTCATAAACTACAGTC
CCGGTGCCAGGATACAAGTTGGCATAAGCTAATGTCGAAA
Chr coordinates Chr IV from 199732-198662
w3c xhtml validator w3c css validator