Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UGA3
Systematic Name YDL170W
Strain S288c
Description Transcriptional activator necessary for gamma-aminobutyrate (GABA)-dependent induction of GABA genes (such as UGA1, UGA2, UGA4); zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type; localized to the nucleus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UGA3 YDL170W
TTCATAAATTCGTGAGGAATACCTAGCAGAATACCGGCACCGTCACCGTTCCCATCAGAT
GAGACGGCACCACGATGTGTCATATTCACTAAAAGATATCTAGCGTCAGTAACAATCTTG
TGAGACTGTTCACCATGCTTATTTGCTACGAAACCGACACCACAAGCGTCATGTTCATAA
TCAGGGTCGTAAAGTCCTCGTTTGTCCGGAATCACATTTGCCCAAGATTTATGAAGATGG
TGTTCATCGTTATAGTTTTGAATTGTCCCACCTTCGTAAGCTTCTTCCAATGGATCGAAA
TTGTCTGATTTCAACACTGGCATGCTTTCTTTTCTAATTCTTTTTCTAGTTCTTCAAAAT
AAATAAATGGCAAATAGATTAAGAAAAAAGAGAGAGTAGAAAGACAAAAATAAATAAAAA
AAAACTGAAGCAGAAAAATAAATAAATAAGTTAAACGTTAATCACTACCTCAATGAGCTA
AAAGAAGGGGAAGAAAGAGCAACTGAGAGTATCCGTCTGCGTAGTATAGGACTGAGATAG
CAATTTCCTATCTTCCTATGATGTGGAGACGATTAGTTTGGTGTGTTATCAAGTAAGATA
TAAGAATTGATTAATTTGGTAAGAAATGAAACAATAGGACGAAAAATACAATAAGATAAG
GAAGACCATCAGAACTTATGAATGACTAAGAAAAGCAGTTTATATTTTTTTTTTGGGCAA
TTTATTGCTTCTTTTTTTTACGTTTTGCGGGCATCACGTTCGTCGTGACATATGACTTGA
AAAATGTGCAAAAGCTTATCGGAGCCAATCGGATTGACGCATTAAAACCGAAGTGTATTA
GGACCAAATTTGCGCTGTATAGGGTTGAACGGTAGGGCTACCAGGGTCTGAGTCATCAAA
GAAAAAGAAATTACAATAAGAGTCTTACTTAAGATGATATAGAATTGTTGTTATTGTTCA
TGTATGGATGCCAAGAAAACAAAGTTTTTTAAAGTGAGGT
Chr coordinates Chr IV from 156318-157904
w3c xhtml validator w3c css validator