Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GLT1
Systematic Name YDL171C
Strain S288c
Description NAD(+)-dependent glutamate synthase (GOGAT), synthesizes glutamate from glutamine and alpha-ketoglutarate; with Gln1p, forms the secondary pathway for glutamate biosynthesis from ammonia; expression regulated by nitrogen source
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLT1 YDL171C
TCTTCCAGCGGTTTTGACAAATATACCTGGTTATCCTGTTCGTCGCTACCGACCCGTCGA
GTACGGGTGGCCACGGCCGCTTTCTGAGCACTGTCAGGAGCATGCTTTCTTTTCTTGCTG
ATCAACTGGTGCTGTATATCTGCCTTTATTTTTTTCAAAGACTGCTTATCAACAGATTCT
GATATATAGATACAGGGAAAACTTAATCGACGACAGTCCCGGCACACAGGTTTATCTTCA
GAGCATCTCTTCTTTCTGATCTTGCAAGTAATACACCCATGCTTCGAATATTTCAATTTC
AGCTTCTCCACGCCATAATTCATACCTCACTTTAAAAAACTTTGTTTTCTTGGCATCCAT
ACATGAACAATAACAACAATTCTATATCATCTTAAGTAAGACTCTTATTGTAATTTCTTT
TTCTTTGATGACTCAGACCCTGGTAGCCCTACCGTTCAACCCTATACAGCGCAAATTTGG
TCCTAATACACTTCGGTTTTAATGCGTCAATCCGATTGGCTCCGATAAGCTTTTGCACAT
TTTTCAAGTCATATGTCACGACGAACGTGATGCCCGCAAAACGTAAAAAAAAGAAGCAAT
AAATTGCCCAAAAAAAAAATATAAACTGCTTTTCTTAGTCATTCATAAGTTCTGATGGTC
TTCCTTATCTTATTGTATTTTTCGTCCTATTGTTTCATTTCTTACCAAATTAATCAATTC
TTATATCTTACTTGATAACACACCAAACTAATCGTCTCCACATCATAGGAAGATAGGAAA
TTGCTATCTCAGTCCTATACTACGCAGACGGATACTCTCAGTTGCTCTTTCTTCCCCTTC
TTTTAGCTCATTGAGGTAGTGATTAACGTTTAACTTATTTATTTATTTTTCTGCTTCAGT
TTTTTTTTATTTATTTTTGTCTTTCTACTCTCTCTTTTTTCTTAATCTATTTGCCATTTA
TTTATTTTGAAGAACTAGAAAAAGAATTAGAAAAGAAAGC
Chr coordinates Chr IV from 155640-149203
w3c xhtml validator w3c css validator