Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDR003W-A
Systematic Name YDR003W-A
Strain S288c
Description Putative protein of unknown function; identified by expression profiling and mass spectrometry
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR003W-A YDR003W-A
CATTGTGAAATCACATATGAATAGATATGTAAGAAGGATTAGAGGGTTCAAGTAATTGTT
GCAGTAGTCAATGTAGCCAAATGTCTAACCACTTTGGTGCATGGAGATTAGCTCAATAAT
CTCGTAGTATGTTTCCGGGTAATATTCTCTGTCTTATTTACCATCTTTATGTTTCCGCCC
TTTTATTTTTGTTTTTCTCGCTACTCCTTTATAATTACTAATGAGAATCGAATACTATAG
AAATTTTTGACGTAATAAAGGAGCAGTAAATTTGGAATACATTCCTTAGCTCGCTAGAAA
GCTGAAGGAAATTTAGCTAAACAGAGAGTATAGTTTTGAAATGATTTTACGGGAGCAGAT
CGACTTCCTAATACATAAAAGACAGGATGATAATAATAACAATGGTGAAGCGATTACAGA
TGATGATCCATTTAGCTCTTCCTCATGGAGATGGGGAAGATGGATTTTTTTTATTTTTTT
CATAGTTGCACTCCTTATACTTCTGTTTTCAACTGCAAAAGTGAATAGGAGAAGAAGAAT
TATGGGTCAAGCTCCGATTAGGGGAACCGCTTGGTTAACCCCGCCTACCTACAGGCAGTC
CGAGAGAGATTACAATGGCACACAGCGTTGCGTTGAAGACTATGTTCCTGAATATACAGA
GACAGCAAATGAGAATGATTTGGGGTTTTACGACGAACGAGGAGAGTTTCATCCTAATGG
CAAAACGGAATATTTAGCGCCACCGCCTTTATCAGAAGAACAAGCTAGCTCGACTGATAA
AGACTTACAGCGCCCAGTGGCTGCCGTCGTACGAATTCCTAGTGAAAGTGAATTCGACTT
CAATCTGCTAAGACCCACTATGAATAATTTCGTTAATGGTCAGAGTAATCGCAACGAGCA
GCATTCTCCGACTGTTGAATCTTCTTCCTTTGATGTTAATAACGCGCCGGCAAGAGCGAA
AGTGAGTAAGTGATTTTTCGTTTAATGAATTTATTATCGC
Chr coordinates Chr IV from 454782-454904
w3c xhtml validator w3c css validator