Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YDR008C
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR008C	6320211 upstream sequence, from -1000 to -1, size 1000
AATCTATATGCTCACCAATCAGATTTACTCTGCCAGGAGACCTAGCGATAAAATCAGGTT
TGACATGGTATGTTTGGAAAAATGCATCTACAACCGCTAAATGTTTTTGTTCGAAAGACC
TTGGTAAATCTCTGACCGGAGAACTGAATATTGGAACGTTTGTATTCATACTATGTGTTG
CCCTACCTTTTTACTTTTATTTTCTCTTTTTGCACTCCTGATTCCGCTAATAGGAAGTAT
GAATACCTGGGGTTGTCAATGTGGTAACAAAGGTGTTGCCTCACTTGTCGCTTATGATGA
TTATATACGTTTCAGTAAAAATTTTACTGCCTATGTGTTGCAGGCGGTCAATCAATTGCA
TAAAAGACCGTGTGATGGCTTGGCATGGCGATTTCATTCTTTCAAGAATTCCACATGTTA
AAATAGTGAAGGAGCATGTTCGGCACACAGTGGACCGAACGTGGGGTAAGTGCACTAGGG
TCCGGTTAAACGGATCTCGCATTGATGAGGCAACGCTAATTATCAACATATAGATTGTTA
TCTATCTGCATGAACACGAAATCTTTACTTGACGACTTGAGGCTGATGGTGTTTATGCAA
AGAAACCACTGTGTTTAATATGTGTCACTGTTTGATATTACTGTCAGCGTAGAAGATAAT
AGTAAAAGCGGTTAATAAGTGTATTTGAGATAAGTGTGATAAAGTTTTTACAGCGAAAAG
ACGATAAATACAAGAAAATGATTACGAGGATACGGAGAGAGGTATGTACATGTGTATTTA
TATACTAAGCTGCCGGCGGTTGTTTGCAAGACCGAGAAAAGGCTAGCAAGAATCGGGTCA
TTGTAGCGTATGCGCCTGTGAACATTCTCTTCAACAAGTTTGATTCCATTGCGGTGAAAT
GGTAAAAGTCAACCCCCTGCGATGTATATTTTCCTGTACAATCAATCAAAAAGCCAAATG
ATTTAGCATTATCTTTACATCTTGTTATTTTACAGATTTT
Chr coordinates
w3c xhtml validator w3c css validator