Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SNQ2
Systematic Name YDR011W
Strain S288c
Description Plasma membrane ATP-binding cassette (ABC) transporter, multidrug transporter involved in multidrug resistance and resistance to singlet oxygen species
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNQ2 YDR011W
GATCTCACAGATGAAGAACTAAAAGACGCAATTATAGTTTCGAAGCCTGCCTTGGGTACT
TGTTTGTACGAACAATAACACTAAACACCTTCTTGGAACAACCTTTAAATATTAAAAGTT
TACTCATACCTCTTACACTCTATAAAGAAACAAGTTGGTGAGTCCAATAGAACCCATTCC
AGCATCCGATGCAACCATAGCCCGGTTGATGCGAGTCAGAGTGGCTCCGCACACAGAGGT
TATGTGACCATGGTAACCGTACACATTTTTCCACGGCAAGGAAGTGGCGCGAAAGAAGCA
CCGCCCTCCACGGATCACCCCATTTGGAAAAGAACGGAGACATAAAAAAAAATTACCTTC
ACGCCAGACTATGTATGACTCGTAGAAATCTAGCATCCGCGGAGCTATTTTAAGTTTCCG
CGGATGCCTTTCGATCCTTTCCCAGTCGTCTGGTTCCGCGCACATATGACTAAATGTCCG
CCCATTTCCGTTTAAATCCGTTTTCTATTTTCTTTAGGTCTTTCCATTGTATTCCCTGCA
ACCCCGCTGGGTATTGGTATTACTAATAGTGACTACGCAACATCAACATATAAAACAAAT
GATGAGTAGTGCCCCTCCCTCACCGCTATCGCCTCACCACTTTTTATGCTTGTATATGCT
TGTAGATAAATAAATACCTAACGAAAACAATATATACGAACCTAGTGTATTTGTATCTTT
TGTTTTTCAAGTTGAAGTGTTGCGAGGTCAAAAAAAAAAAAGCTCACTGTAGGATATAGG
AGTTACTATATCACCAGTGCATTACATTCTCAGTGCATCCATCGTCTTCAACATTGATTA
TTTTCTCCTTCCATTGATTAGAGTTCAAGCTCCCTGAGAAAACGAAGGTATAGCGGACGT
ACCCGCAGAGACATAAAAAAAGAAAAACTATATCGAAGACCGAAAGCAGTAAAAAAGTGG
ATAGAATAACACAGCTACCAAAATACGTAAAGAGAATTCA
Chr coordinates Chr IV from 465919-470424
w3c xhtml validator w3c css validator