Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GCV1
Systematic Name YDR019C
Alias GSD1
Strain S288c
Description T subunit of the mitochondrial glycine decarboxylase complex, required for the catabolism of glycine to 5,10-methylene-THF; expression is regulated by levels of levels of 5,10-methylene-THF in the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GCV1 YDR019C
CACTGGATTTACAAAATACTTTCAAAAGCCTATATAACTCTATCAATATAAGGGTAATAA
ACCTAGATAATATGATAGAAGGGAACATCAAGAGCTACAATAATAACGACTATGATTTTG
ATAATATCCTTAATTTGGTATATGAAAAGCACGCTGTAACTTCTCAAAATGACATGATTC
AACATGATTACGAGGACCCGATAGATTTGATAATAGTATGTGGCTGTTATGCGCTATACG
ATAAACGCATCAACGAAATATCTCAATTAAAAGTATTCTTGGATAGTGATGCAGATAAAA
GATTAATTAGTCTAATCAAGAAGAAGAACGTAGGGAGCAATGAACAACTAGCCCAGTTGA
TCACTGAGTATATGGACCATCTGCGCCCGGAGATGCAACAATATATAGAGCCCACTAGAA
CTTTTGCAGATTTGATCATTCCTTCTACAAATGAAAATCTAGGGCGCGCAGTCCTCGTGG
ACGGTATAGTTAAAGCAATCGAAGATACCAAAAGCCAAATAGAAGGCAACAATACGAACA
ACAAAATACGCCCACGTTTATGGGATTTCGAAGCTGAAACAATGGACTTGGAGAAAGATA
GATATTACGATCTGTCATGAGGTCCTTGCCTTCTATATCTGCGCCACTTTTAATCGGCTC
GATGCGACTAACATCCGTATTTACCCACACAAGCTTATTGATTTTTTTTTTGCATTCTTG
GATCTCGATGGGCGCTTTTACTCCATTAGAACCATGCTCACGGGAAGCTGAGTTCTTACT
TAGAGCTGGTCATAGATATCACCTATTTTGTTCATCGCCGTGACTTCTTTCGGCAGGGCG
ACTCTGCTCAGGAGCCCTGACTCGTGTTGCCTCGAGTAAACGGTATGTCAAAAAGAATAG
GTCCAAATATCATATATATAGCACCTTGAACCCAAACAAATCCAATTACAGTACCCGTAG
CTCACATATGTAGAAAGAGCTTTGCCTGGCACAAGCAATA
Chr coordinates Chr IV from 485365-484163
w3c xhtml validator w3c css validator