Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDR042C
Systematic Name YDR042C
Strain S288c
Description Putative protein of unknown function; expression is increased in ssu72-ts69 mutant
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR042C YDR042C
TCACTAACAACGATATATTATCGTTGAACAATTTACTACGCAAAACAGTTCACGTGATGT
ACGTCAGATAATTCACTGAAGGTACTACCTTTCGAGCATCTCTTACAGCAATGGTAACAG
CTCATTGAAGAAGAAAAAAATAAGACAAATTTTTTTAGAGCTGCAAGCGTTTTACTAGGC
ATCAGAACTGTCTCCGAACAATAGTATAGTTAATTATTATACTTCAACCCTAGAAGAAAT
ACCCGAAGATGTAAGGATGTTTTTGTTCCTATAAGCTTTTTTTTTTCACAAAATTTTCAT
CCACTCTACGTCTTCCATACGGTCATATAAAAGGTGCCATATCCTCGGCCAAGACAAAAG
GCTTCAGCTCCATATCTTTTGAAATCATGTAAACGCATGGGGCTCAAGTACTGAGCAAAG
TAGGAGAAAGGATATTGAACATGTTCAGAAGAACGTGGTATCTTTTTCCTTATTATACAT
TCTCTTGGCGAGTGATCGAAAATATATATGATGATATCCTATAACAACAACAACATGAAT
TTCTTCGTCCGAATCCTTTATAGGTGGAAACAAACTTTGACAATAGCTTTTTAACACTGA
TAATATATTTTCGCGTCATTCTTGCTGATTTTCTTTTTTCTTATTCTTATTGTGCTTCAT
CCTCCATCTTCAATGGCGGTAACGTAAATCAGAGTAGCTTTCATTTTCTTTATTTCTGTT
TCTGTTTCGCGTCGGGATAACAAAGCGTACTTACTAATGGCTATTATTTTTGCTAATGAC
ACAAAATCCTGTTACCAATTTCCAAGAAGAAAGGCGGATAACAGGGAAAAATTTGAATCT
GTGTATCTGCAGTACAAATATTATATATTGGAAGAACACGCACTTATATCTTCTTCATGT
TTGTCATTTTATTAGAAACTTTACTATTGAAAATAGCGAATCAACAACAGCTAACAAACG
ACTAGGTCTCTAAGAGAAAAAATCTTTTTCTTTTCACAAC
Chr coordinates Chr IV from 541203-540601
w3c xhtml validator w3c css validator