Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NRG1
Systematic Name YDR043C
Strain S288c
Description Transcriptional repressor that recruits the Cyc8p-Tup1p complex to promoters; mediates glucose repression and negatively regulates a variety of processes including filamentous growth and alkaline pH response
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NRG1 YDR043C
CAGACGGGCACAGGGACCTAGAACGCCAAGCGCAAAAAAAAGCTGATAGGAATTCGACGT
CACGAACCCTTGGAGTAAAAGAAAACTAAAATATACGAACTTCGCGGAAAATAAAAAACT
TTTCCTTCAGTTGTTCCTCGTTCGAAACAGTAATCTACACGGACCGTTGCTTATTTTTAG
CCAGATTCTAGTTAAATAAAAAAAAAAGAAATAAAATTAAAAAAAAATTAAACTGTGGCA
GATAAGCCTTTCTAATCGAGGCAGTGTGTTTCTTTTGACTTCACCGTTTGTCTTCGCATA
GTTCCCCTAAATATTCTAACTAGAAAAATCGCTAGTATTTTTCTACTTATAAGTTGATTT
TCCGCATATTTGTCTTTGAAACGTTTGAGACAGGGAAAACTCTGTTTTCTAAAAGAGGAA
AAAGCAAAATGAAGTATTGGCTTGGTTGCGGTCAACACCCTCAGGGAAAGCCAAGAAATG
CTTTTTACTGTTTAGCAGTGAAAAGGCCGCACCGGAAAAGAAGGGAAAAATTCATTGGGT
CTAGATTTTTCTTATCGGTAAAAGACTATGGCCTCTTGAGGACCCTTAAGCGTGAAACGA
AACGCGTTGAGCGCGCAGAGGGGCTTCGCCGCCGGTCAGGGTGTTTGGGGTGTTTTTTCT
TTTAATTATTCTCTTGGCAGTGTCATCTTTCTACAGTCTGGCTGCAGGCTCCTTTTCCGT
TATTCATATATAAGGAAGAGAACTTTCCAAACCCAAATTAAAAAAAATTTGGTTCCCATC
TCTTAACTAAAAGAAATTATATTACTCCACCTCGTTTACAGTTTTTTGATGCTATAAGGG
AATTCTGCAGCTTTTGAAAGTAAAAATCATATCGTATACGATTCTGCAAAGTATTATTGT
ACTGTAATTCCTACCATTACGGCGCCTTTTTCTACCATTCACCTTTCTTGGATTGTTCCT
CTCGACCAGCATATTACTACCCTTCGCAAACTTTCAGGCA
Chr coordinates Chr IV from 543369-542674
w3c xhtml validator w3c css validator