Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HEM13
Systematic Name YDR044W
Strain S288c
Description Coproporphyrinogen III oxidase, an oxygen requiring enzyme that catalyzes the sixth step in the heme biosynthetic pathway; transcription is repressed by oxygen and heme (via Rox1p and Hap1p)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HEM13 YDR044W
AGGTAGAAGGTATTGCACCGATTCCTAGTATCAATTCTTTTCAAAACCACTTATTTTGCA
AAACATGCGTCTAACCTGCCATTTCAGCAACGTAAATAATAATTACTTCCATATATATTC
TTCTCCCCCAGTAGCAATTTTGACATGACAAATTTCAGCGATAGTTGCTTCGGCATTCGA
AAATCGTAGAAGTATGTCTTAATGTAGAAGGTTGAGAACAACCGGATCTTGCGGTCATTT
TTCTTTTCGAGGAAAGTGCAAGTCTGCCACTTTCCAGAAGGCATAGCCTTGCCCTTTTGT
TGATATTTCTCCCCACCGTAATTGTTGCATTCGCGATCTTTTCAACAATACATTTTATCA
TCAAGCCCGCAAATCCTCTGGAGTTTGTCCTCTCGTTCACTGTTGGGAAAAACAATACGC
CTAATTCGTGATTAAGATTCTTCAAACCATTTCCTGCGGAGTTTTTACTGTGTGTTGAAC
GGTTCACAGCGTAAAAAAAAGTTACTATAGGCACGGTATTTTAATTTCAATTGTTTAGAA
AGTGCCTTCACACCATTAGCCCCTGGGATTACCGTCATAGGCACTTTCTGCTGAGCTCCT
GCGAGATTTCTGCGCTGAAAGAGTAAAAGAAATCTTTCACAGCGGCTCCGCGGGCCCTTC
TACTTTTAAACGAGTCGCAGGAACAGAAGCCAAATTTCAAAGAACGCTACGCTTTCGCCT
TTTCTGGTTCTCCCACCAATAACGCTCCAGCTTGAACAAAGCATAAGACTGCAACCAAAG
CGCTGACGGACGATCCGAAGATAAAGCTTGCTTTGCCCATTGTTCTCGTTTCGAAAGGCT
ATATAAGGACACGGATTTTCCTTTTTTTTTCCACCTATTGTCTTTCTTTGTTAAGCTTTT
ATTCTCCGGGTTTTCTTTTTTTGAGCATATCAAAAGCTTTCTTTTCGCAAATCAAACATA
GCAAACCGAACTCTTCGAACACAATTAAATACACATAAAG
Chr coordinates Chr IV from 546642-547628
w3c xhtml validator w3c css validator