Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PST1
Systematic Name YDR055W
Alias HPF2
Strain S288c
Description Cell wall protein that contains a putative GPI-attachment site; secreted by regenerating protoplasts; up-regulated by activation of the cell integrity pathway, as mediated by Rlm1p; upregulated by cell wall damage via disruption of FKS1; PST1 has a paralog, ECM33, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PST1 YDR055W
TCTTGTTCTTTACAGATTCAAGAGGAAACCAAAAAAAAATCAAAGAAAAAGAATCGAATT
TTTCCCAAAATGAAAGTGTAAGGAAAAAAAAAGAGGAGATAGAAAATCCGAAGAACCCCA
AGGGACGGACAAACACAAGACGATGCTGCACGTGGTTAGTTTTGTAAGCGCAGGTTACGA
TAAAGAGCATAAACAAATCATTACTAAGAGCGGTATACAAGAATAAAGTGACAAACAGTT
CTCCCTATTTAACGCACTTAACGTAGGTTCCATCATTATGATGCTATTGCCACATCAAAT
CTCCTTTGGACTGAACCCGCATTAGTAATTGCCCGCTTTTCTTTTCTTCCGCGGGTGGGC
CCCATAAATAGAAAAAAAAAGAAAGAAAGCGTTTAAATAAATAGAGTGAGCGGATTTCTA
TTATCTGAAAACCGGGTTATAATGCACGTGATATGCACGTGGGAGCTGGGCGGCTATTTT
TTTCTTTTTCAAATGTATTTGAGTCGTTTAAAATAGCACTCCCCGTTGACCCGCCAACTC
ATTTTTGTTTTCTCTTTACGGAAAAGGCTTTAAATTAAGGCCCGCATTTTCGGTATCCTT
GAGGGAAAAAAACCAAAGAAACCCAAAAAAGACCACAAAGCTGGGATATCTTAATTAGTA
GAGAGGGCTTTTAGTTTTAATAGTGTTACGAGTCTCTAAAAATAGCGTAGGCACACTGCC
CTGATTCGGACTTTGATCAGAGTTTATTACTACAAAGAGTAATGTTGAATGATTGGGCTG
GGTTTTCATAGCATTAACTCTAAGTAATATCATTCAACCGCTCAAGGTTCCTTACGAGCA
AACCCATATATGCTCTACAGATAAACATATAAATAGCGTGCATATTCTTCTCTATTCAAC
TCTTGCTCTGTATAGTTCAATAGAATCTTACAGTACATCACGCTGCAATAGATCTAATCC
AAGAGAGAAGCAAAAAAAAAAAGCTCGCTATAAAAATATC
Chr coordinates Chr IV from 563527-564861
w3c xhtml validator w3c css validator