Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EMC10
Systematic Name YDR056C
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the endoplasmic reticulum; YDR056C is not an essential protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EMC10 YDR056C
CAATTCAGGTATGGTAACTTGGGCTTCATAAACACAAATTTTTGTTTCTCTCACCCATTG
AATAGTCGATGGTCCAGAGTTTGAGCCGCCACAGACATATTGTATTTCAACCATTCTTTC
AGCCCCCGTCACATCGCAAATATCACCTGACCCTATAATTTCGCTGATGTAATATCCTAC
ATCGTCATAAAGTAGTTCAAATTCTCTCTCTTCTACATTTGCTTTTGGTTTTCCCAGGCG
GTAGACCAAAGATTCATCTCGATTTACTATTTCACCAGTTTTTGTATTTACTCTACCATG
GAACTGAACAAATTCTATGCCAGGACAGTACTCGTAAATCCAAAATCCGGCTTGGTAGAA
GATGCACCGTTCATTTAATTTATCGAAAATTGTCTTAACACCTTGATTCAGGGTTTTAGT
TAATAATGCTGTCTTTTCACTATTGCTATGCTCATTTGAGTCTTCCAATACATCATTCAA
TTGAGTGCTTGCATTTTGAATAAAGCATTCAAGGTCGTCGCCCATATTCACTATATATCC
CGAGTTCATGACAGACTGATTTTGTAATATCCTATCACTCCAGTCGTCCTCATCGATGTA
AGATATGAGGTACTTATTCGATACTATGGGGTCTTCTATAGGTGCTAATAGTGATGATCC
TAACGGAATCAACGCAGAAATTGCGCTCAGAGCATATATAATTTTAGCTTGCATTGAAAC
AGGGAAGAAAGGGGATGATAACGATATATGTGAAGATCTATTGCTTATTTTAGGGAATCT
GCTTCTTTTTTATGAAGCTACATTTTTACTTGAAATTTCCGCTGTATTTTTTTGCATACG
TGCGCTGGGTCTCTAACCACTGTATTTGCATTGGTAACTTAAAAACCCAACCAAATATAG
GAATAATTAGAAGTATATAAAAGACACTTTGAGTAAAAAAACAAGGTGGTACTATTCAAC
ACTATCTAACAAGAACTGTACAATACTCATTGAAGGAAAG
Chr coordinates Chr IV from 565640-565023
w3c xhtml validator w3c css validator