Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OCA6
Systematic Name YDR067C
Alias protein-tyrosine-phosphatase
Strain S288c
Description Cytoplasmic protein required for replication of Brome mosaic virus in S. cerevisiae, which is a model system for studying positive-strand RNA virus replication; null mutation confers sensitivity to tunicamycin and DTT
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OCA6 YDR067C
CTCAACTTCTTTTTCCTCCGTTTCCTTTTCCTTTTTGGACAATATTTCTTTCCTTTTACT
TTCTTTATCTAGAATTTTGTTTCTTTGTAAGAAATAGATGTGCCAGAAATCTTTATAGCT
GATTTTATGGGGTACGATGTCGTTCATTAATTTGGAGATATCTTTGTCGCCCTGTAAAAT
AGAACATATCTCCTCAGTTTTTTCATCCACGTCAAACGGGTCCAGTTGCAAATCCATTTT
ATTGTCTAAATAAACCGATTTATCTTTAGATAATGTCCTTAGTTCGGCTTCTGTTCTATT
TCCACCCACAGCAATTTCATTTTCTTTCGAATTCTCATCCTTGTCATTAGAGTCATTTTC
TGCAGCATTATCGAAGCTACTGAAGCCAGACCAAAAATTCTTAGTTTTCATTTTGCTCCA
ATATGACTGGGCTAGACTTTCCACGCTGTGAATATTCTCGTCTAGTTTCTTCAAATACTT
TTGTGCAGTCTCTGTAGTTTCATTGCTAATTGGCAAGTTAATTTCAATTCCGTCATCTTT
CTCGATTACTAACTTTTTGAATGCACTTGTAGTCTTTTCATATCGTTTATTGACTTCCTC
TTCTAACTTTTGGAAGGCCTCATTTGTTTTGTCATCTCGGCTCTGAAGTTCGTTATTTTC
AGTGTTTTCTGTTGATCCAGTTTCCTTGGTATGAGAGTTGCTTATTTTATCATCTTCGAT
ACAAGCTACTTGTTCTTCATAAAAGAATTCCATTTTATCCTAAAACGTCGAAGCAATGGA
GCTCACTAGCTGTACCCTTATGTTGTGTTCTTTTTTTGTTGCATGACTTCTGCTAAGTGC
TTTTTATCATTAATCACCGCTATTTGATGTAAGGCCAAAAAAAATGCGAAAGAAAAAAAG
AGACTCTGTTAAGAAGGAAAGGAGTACCAATATAAACTATGGGTTCACAATTGCTATGAA
TACCCAGTTCACACATCTAGAATAAGCTATATGTATCAAA
Chr coordinates Chr IV from 583465-582791
w3c xhtml validator w3c css validator